qPCR Quantification Protocol Guide

qPCR Quantification Protocol Guide FOR RESEARCH USE ONLY Topics Introduction User-Supplied Consumables and Equipment Select Control Template Dilute qPCR Control Template Dilute Libraries Prepare Reaction Mix Aliquot to 96-Well Plate Quantify by qPCR Analyze Appendix A - Determine Cluster Numbers for Control Library Appendix B - Sample Preparation for Cluster Generation Appendix C - Determine Relative GC Content of Library Introduction This document describes a qPCR method for quantifying libraries generated using sample preparation protocols. qPCR is a method of quantifying DNA based on PCR. qPCR tracks target concentration as a function of PCR cycle number in order to derive a quantitative estimate of the initial template concentration in a sample. As with conventional PCR, it uses a polymerase, dNTPs, and two primers designed to match sequences within a template. For the purposes of this protocol, the primers match sequences within the adapters flanking an Illumina sequencing library. qPCR is, therefore, an ideal method for measuring libraries in advance of generating clusters, because it will only measure templates that have both adaptor sequences on either end which will subsequently form clusters on a flowcell. Moreover, qPCR is a very sensitive method of measuring DNA and thus dilute libraries with concentrations below the threshold of detection of conventional spectrophotometric methods are amenable to quantification by qPCR. Scope There are several different qPCR instruments available from instrument vendors, each with its own proprietary software for running experiments and analyzing data. It is beyond the scope of this document to describe protocols for all instruments and analysis packages. Instead, this document describes a protocol designed around a Stratagene Mx3000P qPCR machine and Stratagene MxPro software. You will need to adapt this protocol to your specific qPCR platform. Quantification Workflow Figure 1 illustrates the qPCR quantification workflow. Dilute the control template and the libraries for quantification to the pM range and run qPCR. From the qPCR results, calculate the concentration of the quantified libraries and dilute them to a standard concentration (e.g., 2 nM). qPCR Quantification Protocol Guide + Control Template Libraries for quantification Dilute control template and libraries for quantification to pM range Run qPCR and generate Ct values x Ct xx Plot standard curve and read off concentrations of quantified libraries Log initial Concentration Figure 1 qPCR Quantification Workflow NOTE During qPCR setup, it is important to avoid DNA crosscontamination. Clean the set up area, including all equipment to be used, thoroughly with 0.5% sodium hypochlorite (10% bleach). Illumina also recommends using a dedicated set of pipettes for qPCR to minimize contamination. NOTE The accuracy of qPCR is highly dependent on accurate pipetting and thorough mixing of solutions. Take extra care to avoid pipetting errors during qPCR set up and when preparing templates for clustering. User-Supplied Consumables and Equipment Check to ensure that you have all of the necessary user-supplied consumables and equipment before proceeding. Table 1 User-Supplied Consumables Consumable Supplier 0.1N NaOH General lab supplier 0.5% sodium hypochlorite (10% bleach) General lab supplier 0.1% Tween 20 General lab supplier 96-well plates Stratagene, part # 410088 Control template (10 nM) General lab supplier Hybridization buffer Illumina, part # 1000166 KAPA SYBR FAST Master Mix Universal 2X qPCR Master Mix (2 x 5 ml =10 ml) Kapa Biosystems, part #KK4602 Libraries to be quantified diluted to approximately 10 nM General lab supplier Optical strip caps Stratagene, part # 401425 Pipettes (P2, P10, P200, P1000, and an 8 channel multichannel dispensing 18 μl) General lab supplier QIAGEN EB 250 ml elution buffer QIAGEN, part # 19086 qPCR primer 1.1: 5' AATGATACGGCGACCACCGAGAT 3' HPLC purified General lab supplier qPCR primer 2.1: 5' CAAGCAGAAGACGGCATACGA 3' HPLC purified General lab supplier One or more of the following kits in order to correspond to the number of libraries to be quantified: a. Single-Read Cluster Generation Kit (1 flow cell) b.Single-Read Cluster Generation Kit (10 flow cells) c. Paired-End Cluster Generation Kit (1 flow cell) d.Paired-End Cluster Generation Kit (5 flow cells) qPCR Quantification Protocol Guide a. Illumina, part # GD-1003-4001 b.Illumina, part # GD-1003-4010 c. Illumina, part # PE-2003-4001 d.Illumina, part # PE-2003-4005 Table 2 Equipment Checklist Equipment Suggested Supplier Benchtop centrifuge with swing out rotor Sorvall Legend RT Benchtop microcentrifuge General lab supplier Genome Analyzer Illumina, part # SY-301-1301 qPCR machine Stratagene Mx3000P Vortexer General lab supplier Select Control Template Before starting qPCR, select the control template against which the libraries for quantification can be measured. In principle, any library prepared for sequencing on the Illumina platform can be used as a control for qPCR and you may wish to tailor a control template to suit your specific needs. The control template should be as similar as possible in terms of template size, GC content and library type (e.g., genomic, CHIP-seq, etc.) to the libraries for quantification. It is also important to note that the control template needs to be available in sufficient quantity, as specified in this protocol, for it to be used in multiple qPCR reactions. In order to correlate library concentration with cluster number, it is recommended to generate a titration flowcell for the control template (see Appendix A - Determine Cluster Numbers for Control Library and Appendix B - Sample Preparation for Cluster Generation). The GC content of a given library is not always known and this poses a problem for matching the library to an appropriate control template for qPCR quantification. However, it is possible to estimate the GC content of Illumina libraries relative to other Illumina libraries of the same template size by performing a limited number of cycles of qPCR followed by a dissociation curve. The higher the GC content of the library, the higher the melting temperature of the PCR product (see Appendix C - Determine Relative GC Content of Library). Once the GC content of a library is known, an appropriate control template can be selected for qPCR quantification. qPCR Quantification Protocol Guide Dilute qPCR Control Template Use the appropriate control library for the libraries you wish to quantify. NOTE Consumables Illumina recommends using a control library that gives a good range of cluster numbers when clustered between 2–20 pM. ` qPCR control template (10 nM) NOTE Store the qPCR 10 nM library template in small aliquots to avoid multiple freeze and thaw cycles. ` 0.1% Tween 20 stored at room temperature (e.g., 50 ml water + 50 μl Tween 20) Procedure 1. Add 198 μl of the 0.1% Tween 20 to 2 μl of the qPCR control template to make a 100-fold dilution. 2. Vortex the dilution to thoroughly mix the samples. 3. Add 100 μl of the 0.1% Tween 20 to 100 μl of the diluted template to make a titration curve of six 2x serial dilutions. This will give 7 control template dilutions in the range of 100–1.6 pM. NOTE It is important to make fresh dilutions of the qPCR control template immediately before qPCR as the DNA does not store well at low concentrations. 4. Vortex the dilution to thoroughly mix the samples. 5. Repeat steps 1 through 4 to produce 3 independent serial dilutions of the control template. NOTE Control dilutions are diluted a further 10X into the final SYBR mix, so the final concentration in the qPCR is 10–0.16 pM. Dilute Libraries The libraries for quantification need to be diluted to the same range as the control template for qPCR. ` Libraries for quantification diluted to approximately 10 nM in QIAGEN Consumables EB Buffer NOTE It is important to make fresh dilutions of the qPCR unknown library template before qPCR as the DNA does not store well at low concentrations. ` 0.1% Tween 20 stored at room temperature (e.g., 50 ml water + 50 μl Tween 20) Procedure 1. Add 998 μl of the 0.1% Tween 20 to 2 μl of the unknown library template to make a 500-fold dilution. This will give an approximate concentration of 20 pM. 2. Vortex the dilution to thoroughly mix the samples. 3. Repeat steps 1 and 2 to produce 3 independent dilutions of the library template. Triplicate results for qPCR are important for subsequent analysis. NOTE qPCR Quantification Protocol Guide Unknown sample dilutions are diluted a further 10X into the final SYBR mix so the final concentration in the qPCR is approximately 2 pM. Prepare Reaction Mix It is important to make a master mix to minimize pipetting errors. The method here makes enough master mix to fill a 96-well plate, but it is possible to make less master mix if you do not wish to use all 96 wells. Consumables Procedure ` ` ` ` KAPA SYBR FAST Master Mix Universal (2x) qPCR primer 1.1 qPCR primer 2.1 Water 1. Prepare the SYBR master mix reaction mix as follows: Consumable μl/well μl/plate (master mix for 110) KAPA SYBR FAST Master Mix Universal (2x) 10 1100 qPCR Primer 1.1 (10 μM) 0.2 22 qPCR Primer 2.1 (10 μM) 0.2 22 Water 7.6 836 18 1980 2. Mix gently but thoroughly. 3. Place the reaction mix on ice and protect it from light until use. Aliquot to 96-Well Plate The next step in the process is to aliquot the control template dilutions, unknown library dilutions, and master mix. It is important during this step to pipette as accurately as possible, because small variations in volumes will greatly affect the qPCR results. ` ` ` ` ` Consumables Procedure Control template dilutions (see Dilute qPCR Control Template) Libraries for quantification dilutions (see Dilute Libraries) Reaction Mix (see Prepare Reaction Mix) 96-well plates Optical strip caps 1. Add 2 μl of the control template dilutions, the unknown library dilutions, or water to each well in a 96-well plate. Take care to pipette accurately into the wells as small variations will affect the assay. For example, the 96-well plate can be filled as follows: 1 2 3 4 5 6 7 8 9 10 11 12 A Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample B Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample C Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample D Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample 100pM 50pM 25pM 100pM 50pM 25pM 100pM 50pM 25pM 12.5pM 12.5pM 12.5pM E 4 3 4 2 3 4 9 10 11 12 9 10 11 12 9 10 11 12 17 18 19 20 17 18 19 20 17 18 19 20 5 5 5 13 13 13 21 21 21 6 6 6 14 14 14 22 22 22 Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample 1.56pM 1.56pM 1.56pM H 3 2 1 Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample 3.13pM 3.13pM 3.13pM G 2 1 Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample 6.25pM 6.25pM 6.25pM F 1 NTC NTC NTC 7 8 Figure 2 7 7 15 15 15 23 23 23 Sample Sample Sample Sample Sample Sample Sample Sample Sample 8 8 16 16 16 24 24 24 Well Plate Format Wells in columns 1–3 contain the control template dilutions and the no template control (NTC) in triplicate. Wells in columns 4–12 contain the sample dilutions in triplicate. 2. Dispense 18 μl of the master mix into each well of the 96-well plates using a multichannel pipette. Take care to pipette accurately into the wells as variations in volume will affect the assay. Change tips for each new column. 3. Place the optical strip lids on the wells, taking care to avoid cross contamination and to avoid smudging the surface of the lids. 4. Centrifuge the 96-well plate to 280 xg for 1 minute. qPCR Quantification Protocol Guide Quantify by qPCR Quantify the libraries by qPCR. Procedure 1. Place the 96-well plate in the qPCR machine in the correct orientation and clean the optical lids with lens tissue to remove any dust before closing the qPCR machine lid. 2. Use the following thermal profile: Procedure Temperature Time Hot start 95ºC 3 minutes 95ºC 3 seconds 60ºC 30 seconds X 40 Analyze The final step in the qPCR procedure is to analyze the quantified libraries. Procedure 1. Check the NTC wells for any amplification. There should be no amplification, but data is acceptable if any amplification is >10 cycles after your last control template amplification. 2. Ensure that there is good amplification for the control template and remove any bad replicates (Figure 3). Figure 3 Example of Control Template Amplification 3. Generate a standard curve from the control template by plotting the Ct values against the log initial concentration (Figure 4). qPCR Quantification Protocol Guide Log Fit Values SYBR Standards, RSq:0.998 SYBR, Y = -3.31*LOG(X) + 14.21, Eff. = 100.4% Figure 4 Example of Standard Curve 4. Ensure that the efficiency of amplification of the control template is 90–110% (a slope of -3.58 to -3.10) and that the R2 >0.9. If not, reassess the datapoints you are using to calculate the standard curve. 5. Lock the threshold fluorescence based on the standard curve. 6. Ensure that there is good amplification for the unknown library templates and remove any bad replicates. 7. Calculate the initial concentration of your unknown library templates based on the standard curve generated from the control template dilutions. NOTE Remember to factor in the 5000-fold dilution of unknown sample. 8. Dilute the quantified library to a standard concentration for clustering. A suggested protocol for preparing sample DNA for cluster generation is given in Appendix B - Sample Preparation for Cluster Generation on page 17. Appendix A - Determine Cluster Numbers for Control Library A titration flowcell can be generated by preparing serial dilutions of template hyb from the control library and counting the number of clusters following the sequencing cycles. NOTE The number of cycles required depends on the Pipeline used. Perform the same number of cycles as the Pipeline, plus 1 cycle, required for phasing. It is necessary to perform multiple cycles of sequencing to achieve an accurate cluster count, since the Pipeline analysis uses the cycles to identify individual clusters in a full length sequencing run. Cluster counts from a first cycle report are not accurate, particularly at high cluster density, due to the different way in which the clusters are counted. A cluster titration for the control template should be linear up until the point at which the clusters become too dense to count accurately, based on current version of the Illumina Genome Analyzer (GA) being used. An example of a library titration is shown in Figure 5. ` ` ` ` Consumables and Equipment Procedure Control library Sequencing reagents (enough for the required number of cycles) Single-Read or Paired-End Cluster Generation Kit GAII_qPCR_v#.xml 1. Prepare serial dilutions of the template hyb from the control library and cluster on a flowcell. NOTE The number of clusters required from the libraries to be quantified by qPCR should fall within the range of the titration flowcell. 2. Perform the sequencing cycles to count the clusters on the titration flowcell. Ensure that there is enough reagent for the run, with a minimum of the following per cycle. These can be left over reagents. • 1 ml of incorporation mix • 0.5 ml of cleavage mix • 2.5 ml of scanning mix For GAII, use the recipe GAII_qPCR_v#.xml. This recipe will scan 9 tiles/ columns. 3. There is no need to change any configuration file on the instrument. The offsets may not be recalculated and the defaμlt_offsets.txt file used might be the one generated during the previous run analysis. To avoid any confusion, make sure that the run name states the name of the GA (e.g. 080908_eas139_0051_FC30BKFAAXX). qPCR Quantification Protocol Guide 4. Use the following settings for the Pipeline analysis: USE_BASES YY. ANALYSIS sequence. 5. Plot the cluster numbers displayed in the summary table against the initial concentration of control template. 6. Calculate the pM concentration required for the desired number of clusters using the equation of the line. Figure 5 Example of Library Titration In Figure 5, an E. coli control library with a template size of 300 bp was clustered on four flowcells at 16 pM, 8 pM, 4 pM, 2 pM, 1 pM, 0.5 pM, and 0.25 pM and clusters were counted through the Pipeline following five cycles of sequencing. Appendix B - Sample Preparation for Cluster Generation Independently of DNA quantification, it is important to be able to achieve precise cluster numbers (i.e., a given library clustered at the same concentration should always give the same number of clusters). However, it is often observed that the same library clustered on separate occasions can give different cluster numbers and this can be attributed to the small pipetting volumes and large number of pipetting steps involved in the current cluster protocol. Illumina recommends a modified protocol for clustering to achieve more consistent cluster numbers when the same library will be used on multiple flow cells or lanes. ` DNA Library ` QIAGEN EB Buffer + 0.1% Tween 20 (QIAGEN EB Tween) Consumables and Equipment (e.g., 50 ml QIAGEN EB + 50 μl Tween) ` ` ` ` ` 0.1N NaOH Hybridization Buffer Vortexer Benchtop Microcentrifuge Pipettes (P2, P10, P200, P1000, and an 8 channel multichannel dispensing 18 μl) NOTE Procedure To minimize errors in preparing 0.1N NaOH fresh each day, prepare it in large batches and aliquot it into 50 ml sealed tubes. These aliquots may be stored up to 6 months at 2° to 8°C and used in the protocol as needed. Once you open an aliquot, use it on the same day that it was opened. Discard any reagent that is left at the end of the day. 1. Dilute the DNA library templates to 2 nM based on qPCR quantification in QIAGEN EB Tween using a minimum volume of 10 μl using a P10 pipette. 2. Denature 10 μl of 2 nM template DNA by adding 10 μl 0.1N NaOH to generate 20 μl of a 1 nM denatured template using a P10 pipette to make the dilutions. 3. Vortex the template solution. 4. Centrifuge the template solution to 280 xg for 1 minute. 5. Incubate for 5 minutes at room temperature to denature the template into single strands. 6. Add 980 μl of pre-chilled hybridization buffer using a P1000 pipette to the tube containing the denatured template solution to generate a 20 pM template hyb solution. qPCR Quantification Protocol Guide 7. Vortex the template hyb. NOTE You may aliquot into smaller volumes to avoid multiple freeze/thaws. If so, the volumes should be large (e.g., 250 μl) to enable accurate pipetting for further dilutions. The 20 pM template hyb solution can be diluted using large volume pipetting to the correct concentration for clustering, as judged from the qPCR control template titration flowcell. Any remaining 20 pM template hyb can be stored at -15º to -25ºC for up to 3 weeks. Storage of the 20 pM template hyb solution enables you to re-use the same template hyb with the possibility of clustering at a different concentration at a later time. By storing the 20 pM template hyb you do not have to begin the cluster process again from the 2 nM stock, thus preventing any further cluster number variability. Since the libraries are quantified by qPCR before clustering it is assumed that a concentration above 20 pM would not be required. Appendix C - Determine Relative GC Content of Library The GC content of a library is not always known, but it is possible to estimate the GC content of Illumina libraries relative to other Illumina libraries of the same size by performing a dissociation curve on the qPCR instrument. The higher the GC content of the library then the higher the melting temperature. Therefore, libraries of the same template length can be directly compared and GC content of unknown libraries estimated relative to libraries of known GC content (Figure 6). Plasmodium falciporum (20% GC) Human (40% GC) E. coli (50% GC) TB (65% GC) Figure 6 Example of Dissociation Curves Generated for 300 bp Illumina Libraries Consumables and Equipment qPCR Quantification Protocol Guide ` ` ` ` ` ` ` Illumina libraries of known GC content (~10 nM) Illumina libraries of unknown GC content (~10 nM) KAPA SYBR FAST Master Mix Universal 2x qPCR machine 96-well plates Optical strip caps Benchtop centrifuge with swing out rotor Procedure 1. Prepare the following reaction mix for each library (including controls) in a 96-well plate/reaction Consumable μl/reaction KAPA SYBR FAST Master Mix Universal (2x) 10 qPCR Primer 1.1 (10 μM) 0.2 qPCR Primer 2.1 (10 μM) 0.2 Water 7.6 Illumina library (approx 10 nM) 2 20 2. Put the optical strip lids on the wells and briefly spin the 96-well plate down in a bench top centrifuge to 280 xg for 1 minute. 3. Place the 96-well plate in the qPCR machine in the correct orientation and clean the optical lids with lens tissue to remove any dust before closing the qPCR machine lid. 4. Use the following thermal profile: Procedure Temperature Time Hot start 95ºC 3 minutes 95ºC 3 seconds 60ºC 30 seconds X 10 5. At the end of the thermal profile ramp slowly from 60º to 95ºC to generate a dissociation curve.