5.36 Lecture Summary #2

5.36 Lecture Summary #2 Tuesday, February 10, 2009 Next Laboratory Session: #3 ________________________________________________________________________________ Topics: Molecular Cloning and Site-Directed Mutagenesis I. Overview of Molecular Cloning II. Ligation (Step 1 of Cloning) A. Polymerase chain reaction (PCR) B. Restriction enzymes and gene insertion C. Session 3: digestion to check for the Abl(229-511) insert III. DNA Site-Directed Mutagenesis A. PCR primer design B. Overview of the Quickchange strategy (preview of sessions 9-11) ________________________________________________________________________________ I. OVERVIEW OF MOLECULAR CLONING REVIEW OF DNA The central dogma of biology: DNA → RNA → protein (→ protein folding and post-translational modification) We are interested in expressing and studying proteins, so we need to start with the correct DNA or alter the DNA to make desired protein mutants. H OH O O P N N HC O O O A C N O O H C C H N N P CH3 C C C N N CH CH O P O T Adenine (a) O _____________ ( ___ ) P H P O G O O O P O O N H O N HC C C N C C N H N C CH C N N CH HO N _______________________ backbone H O H Guanine (g) _____________ ( ___ ) The 5’ end of a DNA strand terminates with a ______________ group. The 3’ end of a DNA strand terminates with a _______________ group. By convention, we write a DNA sequence ____’ to ____’. A DNA single strand is defined as a _____________ strand if the mRNA version of the identical sequence can be translated to a protein. The compliment DNA sequence (the opposite strand) is called the _______________ strand. Hydrogen bonding binds together complementary strands of DNA to form a double helix. The lower bond enthalpies of hydrogen bonds compared to covalent bonds facilitate the separation of DNA strands during DNA replication. DNA CLONING: IN-VIVO AMPLIFICATION OF DNA 1. ____________________ 2. ____________________ 3. ____________________ In Modules 4 and 5, we are using E. coli cells for storage and expression. _________ for storage. _____________ for protein expression. For lab Session 2, you were provided with: • BL21(DE3) cells transformed with an H396P Abl(229-511)-encoding vector for protein expression. • DH5α cells transformed with a wt Abl(229-511)-encoding vector for isolation of the wt vector DNA (by doing a miniprep). II. LIGATION (step 1 in molecular cloning) A) POLYMERASE CHAIN REACTION (PCR) How do we get enough of the desired DNA insert to work with for the ligation? How can we introduce RE cut sites into the insert DNA? Answer: PCR • Allows you to amplify desired regions of DNA • Utilizes in vitro enzymatic replication by a polymerase (such as Taq or Pfu) polymerase: an enzyme that catalyzes the polymerization of deoxyribonuclotides (dATP, dGTP, dTTP, and dCTP) into a strand of DNA. 5' 3' 3' 5' 1) Denaturation 3' 5' 5' 3' 2) Annealing 5' 3' 3' 5' 5' 3' 3' 5' 3) Elongation 5' 3' 5' 3' 3' 5' 3' 5' 1)Denaturation 2) Annealing 3) Elongation 3' 5' 3' 5' 5' 3' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 3' 1)Denaturation 2) Annealing 3) Elongation 5' 3' 5' 5' 5' 3' 5' 3' 3' 5' 3' 5' 3' 5' 5' 3' 3' 5' 3' 5' 3' 5' General components of any PCR reaction: • Template DNA. DNA that includes the desired sequence to be amplified. • Nucleotides (________s). The building blocks to build new DNA strands. • Primers. Complimentary _________ to the start and end of target sequence. • A _________________ polymerase (such as Taq or Pfu) • A buffer compatible with the polymerase • Thermal cycler 5' Exponential growth of the PCR product with continuing cycles 3' General PCR protocol for thermal cycling: • Initialization Step (92 oC for 2 min): Activates the heat-stable polymerase • 25-30 cycles of 1) Denaturation Step (___ oC): denatures template DNA 2) Annealing Step (___ oC): allows ________ to anneal to target sequences 3) Elongation Step (72 oC): elongation of the annealed primers • Final Elongation Step (72oC for 10 min) For a video of pcr in action, see http://www.dnalc.org/ddnalc/resources/animations.html. PCR yields enough of the target DNA insert for subsequent ligation. B) RESTRICTION ENZYMES AND GENE INSERTION Question: How do you get the desired DNA insert into the vector? Restriction Enzymes (also called ___________________) selectively cut DNA within a specific sequence (called a ______________ site) by cleaving a ___________________ bond within the DNA backbone. For restriction enzymes that cleave double-stranded DNA, some cut straight across the DNA molecule producing _________ ends. Others cut in an offset fashion producing _________ ends. Examples of restriction enzymes and their corresponding recognition sites: “blunt end” REs Sma1 5'...CCCGGG...3' 3'...GGGCCC...5' Alu1 5'...AGCT...3' 3'...TCGA...5' Sca1 5'...AGTACT...3' 3'...TCATGA...5' EcoRV 5'...GATATC...3' 3'...CTATAG...5' “sticky end” RE’s __________ 5'...CATATG...3' 3'...GTATAC...5' __________ 5'...CTCGAG...3' 3'...GAGCTC...5' EcoR1 5'...GAATTC...3' 3'...CTTAAG...5' BamH1 5'...GGATCC...3' 3'...CCTAGG...5' Sac1 5'...GAGCTC...3' 3'...CTCGAG...5' Circle the RE sites above that are found in the cloning region of the pET-28a vector: 5’CCATATGGCTAG…GGATCCGAATTCGAGCTCCGTCGACAAGCTGCGGCCGC ACTCGAG 3’ Resources for visualizing/identifying RE cut sites • The information sheet that comes with commercial vectors. (The pET-28a vector information sheet will be available in the lab for session #3.) • Vector visualization software: Ape (free) http://www.biology.utah.edu/jorgensen/wayned/ape/ Vector NTI (free if you provide an academic e-mail address) https://catalog.invitrogen.com/index.cfm?fuseaction=userGroup.home So how was the wt Abl(229-511)-containing vector DNA (isolated in Session 2) constructed? Cut both desired DNA fragment and vector with the same restriction enzymes (a digestion) then incubate together. Use a DNA Ligase to connect 5’ and 3’ sticky ends and create a continuous plasmid. C) LAB SESSION 3: DIGESTION TO CHECK FOR THE ABL(229-511) INSERT It is common to receive cloning/expression vectors containing a DNA insert of interest from another laboratory…and it is wise to check that these vectors contain the DNA you are expecting. You can check your vector by: • DNA ______________ (This is the most thorough method.) • Restriction digestion (to confirm the DNA insert size and location) Session 3 will entail restriction digestion of the wt Abl(229-511)-encoding vector. The 849-bp ABL DNA insert should be between the Xho1 and Nde1 restriction sites of the pET-28a vector. You will set up four digestion reactions, with the following expected results: • • • • no-enzyme “digestion” Xho1-only digestion Nde1-only digestion Xho1 / Nde1 digestion → → → → 6138-bp ___________ vector DNA 6138-bp ___________ vector DNA 6138-bp linear vector DNA ______-bp linear vector and 849-bp insert (See page 13 of you lab manual for a sample gel.) III. DNA SITE-DIRECTED MUTAGENESIS What you have: a wt Abl(229-511)-encoding plasmid (isolated in Session #2) What you want: a plasmid encoding an Abl (229-511) mutant. You will use the Quickchange strategy to generate mutant DNA that encodes the corresponding Bcr-Abl protein mutant of your choice. The Bcr-Abl kinase domain aa sequence: V V E DITMKHKLGG 310 LLGVCTREPP 370 HRDLAARNCL (229)SP NYDKWEMERT HF V RH K 260 270 GA280 A 300 GQYGEVYEGV WKKYSLTVAV KTLKEDTMEV EEFLKEAAVM KEIKHPNLVQ N A L I L320 330 340 T 350 T G V FYIITEFMTY GNLLDYLREC NRQEVNAVVL LYMATQISSA MEYLEKKNFI R I L F390 PP400 410 Y420 VGENHLVKVA DFGLSRLMTG DTYTAHAGAK FPIKWTAPES LAYNKFSIKS 430 440 450 K 470 480 DVWAFGVLLW EIATYGMSPY PGIDLSQVYE LLEKDYRMER PEGCPEKVYE LMRACWQWNP S 490 500 510 SDRPSFAEIH QAFETMFQES SISDEVEKEL G A) PCR PRIMER DESIGN FOR QUIKCHANGE MUTAGENESIS After selecting your target amino acid mutation, you will design primers to create the corresponding DNA mutation. Each group should turn in a primer design worksheet (p. 55 of the lab manual) to their TA during lab session #4. Abl(229-511) nucleotide sequence (Appendix B of your lab manual): acggacatca gtgtggaaga gtggaagagt cagctccttg tacgggaacc ctgctgtaca atccacagag gctgattttg aagttcccca tccgacgtct tacccgggaa cgcccagaag ccctctgacc tccagtatct ccatgaagca aatacagcct tcttgaaaga gggtctgcac tcctggacta tggccactca atcttgctgc gcctgagcag tcaaatggac gggcatttgg ttgacctgtc gctgcccaga ggccctcctt cagacgaagt (688)tcc caagctgggc gacggtggcc agctgcagtc ccgggagccc cctgagggag gatctcgtca ccgaaactgc gttgatgaca tgcacccgag agtattgctt ccaggtgtat gaaggtctat tgctgaaatc ggaaaaggag cccaactacg gggggccagt gtgaagacct atgaaagaga ccgttctata tgcaaccggc gccatggagt ctggtagggg ggggacacct agcctggcct tgggaaattg gagctgctag gaactcatgc caccaagcct ctgggg acaagtggga acggggaggt tgaaggagga tcaaacaccc tcatcactga aggaggtgaa acctggagaa agaaccactt acacagccca acaacaagtt ctacctatgg agaaggacta gagcatgttg ttgaaacaat gatggaacgc gtacgagggc caccatggag taacctggtg gttcatgacc cgccgtggtg gaaaaacttc ggtgaaggta tgctggagcc ctccatcaag catgtcccct ccgcatggag gcagtggaat gttccaggaa 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 1441 1501 Note: amino acid 229 corresponds to nucleotides 688-690 (not 685-687 as might be expected) because there are 3 bases prior to the start of the open reading frame. For example, let’s design primers to make the T315I mutant. Note that complete instructions on primer design can be found on page 54 in Appendix C of your lab manual. The Thr315 amino acid corresponds to bases ________________. Original nucleotide sequence including the 12 bases on either side of the mutant codon: 5’ ccc ccg ttc tat atc atc act gag ttc atg acc tac ggg 3’ Ala/A GCU, GCC, GCA, GCG Arg/R CGU, CGC, CGA, CGG, AGA, AGG Asn/N AAU, AAC Asp/D GAU, GAC Cys/C UGU, UGC Gln/Q CAA, CAG Glu/E GAA, GAG Gly/G GGU, GGC, GGA, GGG His/H CAU, CAC Ile/I AUU, AUC, AUA START AUG Leu/L Lys/K Met/M Phe/F Pro/P Ser/S Thr/T Trp/W Tyr/Y Val/V STOP UUA, UUG, CUU, CUC, CUA, CUG AAA, AAG AUG UUU, UUC CCU, CCC, CCA, CCG UCU, UCC, UCA, UCG, AGU, AGC ACU, ACC, ACA, ACG UGG UAU, UAC GUU, GUC, GUA, GUG UAG, UGA, UAA (You can alternatively use a DNA-to-protein translation program to check your DNA (http://www.expasy.ch/tools/dna.html). T315→I is a ______→___ nucleotide point mutation Forward primer: 5’ ccc ccg ttc tat atc atc att gag ttc atg acc tac ggg 3’ Reverse primer (the reverse compliment): 3’ ggg ggc aag ata tag tag taa ctc aag tac tgg atg ccc 5’ 5’ ccc gta ggt cat gaa ctc aat gat gat ata gaa cgg ggg 3’ Check that your primers have a minimum GC content of 40%. B) OVERVIEW OF QUIKCHANGE STRATEGY (Preview of Sessions 9-11) Modified from the QuikChange handbook (http://www.stratagene.com/manuals/200518.pdf). Step 1: plasmid preparation LEGEND * * ** target site for mutation mutagenic primer parental DNA plasmid mutated DNA plasmid Step 2: thermal cycling (_____) (session 9) *** * mutagenic primers *** Note: for PCR using mutagenic primers • Instead of replicating just a desired fragment, replicate the entire plasmid • Need a much more powerful polymerase that has higher fidelity than Taq • Use Pfu Turbo (isolated from pyrococcus furiosus) • _________________ gives Pfu Turbo higher fidelity. Step 3: Digest the methylated, non-mutant DNA template with Dpn 1. (session 10) mutated plamid (contains nicked circular strands) ** Step 4: Transformation (session 10) ** Isolate mutant DNA (session 11) and send for sequencing. Quikchange allows you to make point mutants in one day (or several days when limited to 4-hour lab session). Less than 25 years ago it took months to make point mutants. PCR, Quikchange, and similar cloning techniques have been instrumental in advancing recombinant technologies and making molecular biology methods much more efficient