Chemistry Answers Chapter 13

Chapter 13 Exercises 1 C18H32O16 + 2H2O → 3C6H12O6 2 Monomers must each have two functional groups. A molecule of water is given off for each bond that forms between the monomers. 3 (a) anabolic (b) catabolic (c) catabolic (d) anabolic 4 Sunlight, photosynthetic pigments to absorb light energy, water and carbon dioxide. Carbon dioxide is reduced by the hydrogen from water, forming carbohydrate. The oxidation state of carbon decreases from +4 in CO2 to 0 in C6H12O6. Oxygen is oxidized from −2 in H2O to 0 in O2. 5 Aerobic respiration yields a great deal more energy than anaerobic respiration, as in the presence of oxygen the oxidation of glucose to CO2 and H2O is complete. In anaerobic respiration, oxidation is incomplete, and much of the energy remains in the end products such as ethanol. 6 (a) Tyr–Val–His; Tyr–His–Val; His–Tyr–Val; His–Val– Tyr; Val–His–Tyr; Val–Tyr–His There are a six different tripeptides possible from three amino acids: 3 × 2 × 1 (b) There are 24 different peptides that can be synthesized from four amino acids: 4 × 3 × 2× 1 69 10:02 Answers 8 9 10 (a) leucine (b) threonine (c) glutamic acid (d) lysine 11 Fibrous proteins are usually elongated molecules with a well-defined secondary structure. They are structural materials and insoluble in water. Globular proteins have a well-defined tertiary structure and are compact spherical molecules, soluble in water. They are functional as enzymes, carriers, hormones and receptors. Hydrogen bonds in the secondary structure are between groups that are part of the peptide bonds of amino acids four residues apart in a polypeptide chain. Hydrogen bonds in the tertiary structure are between groups such as –OH in the side chains of amino acids. (a) and (b) rate of reaction 7 no inhibitor competitive inhibitor [substrate] (c) (i) no effect on Vmax (ii) Km increases 12 Similarities: both increase rate of reaction by providing pathway of lower Ea; both have no effect on Kc or yield. Differences: enzymes are proteins, inorganic catalysts have a varied structure; enzymes show saturation kinetics, inorganic catalysts usually do not; enzymes are regulated by inhibitors, inorganic catalysts are usually not; enzymes are sensitive to pH and temperature, inorganic catalysts usually work well at a wide range of temperature and pressure. (a) Enzymes are biological catalysts; they are made of proteins; they are very specific in their action; they are affected by changes in temperature and pH; during the reaction they form an enzyme–substrate complex in which the reaction occurs. (b) rate of reaction 13 (a) Hands are likely to carry free amino acids that could be deposited on the paper and interfere with the chromatogram. (b) Isoleucine has an isoelectric point = 6.0 Therefore, at pH < 6.0 it will be positively charged and so attracted to the cathode; at pH > 6.0 it will be negatively charged and so attracted to the anode. optimum temperature The shape shows increasing rate with increasing temperature as a result of the increase in average kinetic energy leading to more successful collisions between enzyme and substrate. This continues to a maximum point (close to 40 °C in humans), known as the optimum. At temperatures higher than this, the rate of the reaction falls dramatically as the enzyme is denatured. This means that it loses its specific tertiary structure and can no longer bind the substrate at the active site. (c) Glutamic acid has an isoelectric point = 3.2 Histidine has an isoelectric point = 7.6 Therefore, pH between 3.2 and 7.6 would achieve separation, e.g. pH 5.0. Glutamic acid will be negatively charged and attracted to the anode. Histidine will be positively charged and attracted to the cathode. 14 75 cm3 of 0.05 mol dm−3 NaOH 15 A series of dilutions (< 5) is prepared of a protein standard solution. These are treated with a reagent (such as Biuret solution) which generates 70 10:02 colour according to the protein content. Absorbance of each solution is measured under carefully controlled conditions of temperature, wavelength and volume of reagent added. The calibration curve is plotted of absorbance versus protein concentration. The same conditions are applied to the experimental solution, whose protein concentration can then be read from the calibration curve. 16 (b) Water-soluble: vitamin C; fat-soluble vitamin A / vitamin D. Vitamin C has many –OH and polar groups able to form hydrogen bonds with water. Vitamins A and D are predominantly nonpolar/have hydrophobic groups and so cannot form hydrogen bonds with water. 22 Fortification of certain staple foods such as rice and flour with micronutrients; supply of nutritional supplements particularly in places where certain deficiencies are known (e.g. iodine); possible changes and improvements in nutrient content through genetic modification. 23 (a) Polynucleotides form by the condensation reactions between nucleotides. Phosphate groups react with ribose sugar molecules at C3 and C5 forming phosphodiester links between the sugar molecules. The backbone of the polynucleotide strand is an alternating sequence of sugar and phosphate groups. 10.16 moles I2 254 = 0.04 moles I2 10.16 g I2 = Therefore, 0.02 moles fat react with 0.04 moles I2 so there are two double bonds in the fat. 17 (a) Melting point above 25°C: lauric, myristic, palmitic and stearic acids are solids at room temperature. (b) Melting point increases as London dispersion forces increase with size of the R group, due to an increase in number of electrons. (c) An increase in the number of the C=C double bonds adds kinks to the structure which reduces the ability of the molecules to pack together. The intermolecular forces are weaker and the melting points decrease. 18 Fats and oils; hydrolytic and oxidative rancidity. 19 (a) CH2O (b) Monosaccharides are water soluble as they are small molecules with many free –OH groups which can form hydrogen bonds. Polysaccharides are insoluble as they are much larger molecules. CH2OH 20 H OH O H H O H H H OH H H H OH OH H OH Lactose C12H22O11. Glycosidic bond. 21 24 (a) Carbon–carbon double bonds and hydroxyl groups. (a) TTAGCGTATATTAAGCGATCG (b) UUAGCGUAUAUUAAGCGAUCG (c) There are seven base triplets so seven amino acids can be inserted. CH2OH O OH (b) The double helix of the DNA molecule is stabilized by hydrogen bonds between the complementary pairs of bases. Guanine and cytosine pairs are held together by three hydrogen bonds, and adenine and thymine pairs by two hydrogen bonds. The molecule is also stabilized by hydrophobic interactions between the stacked bases in the interior of the helix. 25 Benefits Concerns Improved flavour, texture and nutritional value Uncertainties about the outcomes Longer shelf-life Links to increased allergies (for people involved in their processing) 71 10:02 Answers 26 27 28 Benefits Concerns Increased crop yields in plants and feed efficiency in animals Pollen from GM crops may escape to contaminate ‘normal’ crops When a substance is oxidized, electrons are transferred and the oxidation number of the substance is increased. This happens to Fe in cytochromes when they act as electron carriers. Oxygenation does not involve transfer of electrons and there is no change in oxidation number; it involves the bonding of a molecule of oxygen as a ligand. This happens in hemoglobin when it forms oxyhemoglobin. Colour absorbed curve of myoglobin is hyperbolic, representing saturation kinetics with no cooperative binding, as myoglobin contains a single heme group and no quaternary structure. 31 The carbon–carbon double bonds that remain in partially hydrogenated fats are changed from cis to trans configurations. Trans fats are associated with a number of negative health effects, including cardiovascular disease. Complete hydrogenation results in fats that have no carbon–carbon double bonds. 32 Cellulose is a polymer of β-glucose. It has –OH groups sticking out on both sides of its chains, so hydrogen bonds between them form microfibrils, which give it rigidity. It is used for support. Starch is a polymer of α-glucose, forming compact and spiral molecules. 33 Light activates the conversion of 11-cisretinal to the all-trans isomer, which causes its dissociation from opsin and the triggering of a nervous impulse. 34 Ionic bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions. 35 Biomagnification refers to the increasing concentration of a xenobiotic substance at different levels in a food web. It is often associated with toxic effects for organisms that feed at a high trophic level, as their cells contain the highest concentrations. 36 Break down oil spills, help break down some plastics, in biological detergents that improve energy efficiency, in Green Chemistry involving less toxic chemical pathways and solvents. Colour of pigment pH λmax 1 550 Green Red 7 350 None visible Colourless (a) The carotenoids are coloured due to the presence of an extended π system of electrons in their molecules. They are not water soluble as the molecules contain a non-polar hydrocarbon chain. They are soluble in non-polar fats and oils. (b) The colour is due to the presence of anthocyanins. These are water soluble as the molecules contain polar hydroxyl groups which form hydrogen bonds with water. The colour changes in the presence of acid as the degree of conjugation of the π system is reduced when anthocyanins are protonated. This changes the wavelength of the light absorbed. 29 A: 0.17; B: 0.50; C: 0.67 Polar molecules interact fairly strongly with the polar Si– O bonds of the stationary phase and so have smaller Rf values. 30 Oxygen dissociation curve of hemoglobin is sigmoidal, representing cooperative binding between the four heme groups within the quaternary structure. Oxygen dissociation Challenge yourself 1 The entropy of the environment increases. Energy is returned as less useful forms such as heat and other forms which quickly become randomized. Order is created at the expense of the environment, which becomes more disordered. 72 10:02 2 3 4 5 In C6H12O6 the oxidation state of C = 0 Leu–His –Arg In CO2 the oxidation state of C = +4 Award [3] for all six correct, [2] for five or four, [1] for three. Threonine and isoleucine have two chiral carbon atoms. (d) (i) Hydrogen bonding [1] (ii) van der Waals forces / hydrophobic interactions / dispersion forces Proline is a secondary amine; all other amino acids are primary amines. In peptides, proline does not have any hydrogens bonded to N, so cannot be a hydrogen bond donor, but can be a hydrogen bond acceptor. The presence of proline leads to a bend or kink in the polypeptide chain. Ionic bonding / (formation of) salt bridges/ electrostatic attractions Covalent bonding / (formation of) disulfide bridges [2 max] Award [1] each for any two. Do not accept sulfur bridges or hydrogen bonding. (a) first order (b) mixed order (c) zero order 6 [3 max] 2 (a) (i) CH2OH succinate = butanedioate H OH fumarate = trans-butenedioate [3] CH2OH O H H O H H H H OH H H OH O HO OH malonate = propanedioate H 7 8 9 Oxidation state of carbon will be higher in a carbohydrate than in a lipid. Threonine and isoleucine have four stereoisomers, as they each have two chiral C atoms. OH (ii) C12H22O11 + H2O → 2C6H12O6 [2] (iii) catabolism [1] Accept hydrolysis. O OH H β-Glucose is more stable because there is less steric hindrance in the trans position. H OH H OH 1 water / H2O CH [2] CO NH CH2 SH H 2N CH CO CH2 OH (c) Arg–His–Leu Arg–Leu–His His–Arg–Leu His–Leu –Arg Leu– Arg–His NH OH Accept structures given as repeating unit with open bonds at the –OH groups at positions 1 and 4. (a) condensation (b) H2N H H Practice questions [1] CH2OH (b) (i) CH COOH [2] CH2 OH CH COOH CH2 SH (ii) starch forms a compact spiral structure / granular / amorphous cellulose forms microfibrils / cables / rigid structure cellulose can form hydrogen bonds between chains due to β-glycosidic links (and starch cannot) [3] 3 (a) rate of reaction increases with temperature from approximately 0 to 35°C increasing kinetic energy of enzyme and substrate increases the probability of a 73 10:02 Answers catalytic action / alternative pathway of lower activation energy occurs due to binding of substrate to enzyme (a) Hemoglobin has a compact structure and a specific three-dimensional conformation. Its shape is determined by both its tertiary and quaternary structures. [3] (b) at 40°C tertiary structure / conformation of enzyme starts to break down / denature and less enzyme–substrate complex forms above 40°C enzyme is denatured / unable to bind to substrate [5] (b) optimum temperature / maximum rate of reaction at temperature lower than 40°C graph rises more quickly at low temperatures 4 [4] 100 80 60 40 20 0 0 2 4 6 8 10 12 14 partial pressure of oxygen/kPa (c) Binding of O2 to the first subunit causes a conformational shift, which facilitates the binding of O2 to the subsequent subunits. [2] [2] (a) (i) linoleic acid C17H31COOH so has two C=C bonds (d) 2 moles I2 react with 1 mole linoleic acid 2 × 254 g react with 280 g 508 × 100 100 g linoleic acid reacts with 280 = 181 g I2 [3] (ii) X has fewer C=C double bonds / is less unsaturated / more saturated [1] 100 low pCO2 pH 7.6 80 60 high pCO2 pH 7.4 40 20 0 0 2 4 6 8 10 12 14 partial pressure of oxygen/kPa Actively respiring cells release CO2 / lower pH. This shifts the O2 dissociation curve to the right, so that the blood is less saturated with O2. Oxyhemoglobin dissociates more readily at low pH. [3] (iii) X has higher melting point as molecules pack more closely unsaturation puts kinks in the hydrocarbon chains / less close packed / weaker intermolecular forces [2] (e) In the presence of O2 from the air, hemoglobin in the meat is converted to oxyhemoglobin, which helps give meat a bright red colour. [2] (b) Hydrolytic rancidity: fat breaks down by hydrolysis at the ester links between glycerol and fatty acids, releasing the free acids. Favoured by high temperature and enzyme lipase. [3] (f) The oxygen dissociation curve for myoglobin: (i) lies to the left of hemoglobin – it has a greater affinity for O2; (ii) is not a sigmoidal shape but hyperbolic as there is no cooperative binding. [4] Oxidative rancidity: unsaturated fat is oxidized at the carbon–carbon double bonds forming volatile aldehydes and ketones. Favoured by light and enzymes or metal ions. [3] (c) Lipids release more energy per unit mass on oxidation than carbohydrates, as they are more reduced. Lipids are insoluble and difficult to transport so their breakdown is more difficult and slower than carbohydrates. [3] % saturation of hemoglobin 5 % saturation of hemoglobin successful collision forming an enzyme– substrate complex 6 Benefit: enhanced taste/flavour/quality/nutrients/vitamin A / longer shelf life / greater yield / greater resistance to pesticides/disease 74 10:02 Concern: 11 increased allergies / changed composition of balanced diet / unknown health consequences in food chain / risk of escape to wild population / lack of knowledge of potential consequences to ecosystem 7 (a) deoxyribose sugar, phosphoric acid, nitrogenous base (purine/pyrimidine) [2] (c) PVC contains the C–Cl bond for which no enzyme exists in the environment [2] (a) catalyse/speed up chemical reactions (in the body) / make reactions possible at body temperature / lower activation energy. [1] (c) (i) CGGATGAATCGAT (b) Vmax = 0.46 µmol min−1 12 Km = [S] when v = 21 Vmax = 1.2 mmol dm−3 [2] [2] Accept 1.1–1.3 mmol dm−3. (a) pigments absorb visible light Penalize once for wrong/no units. and scatter/reflect/transmit the remaining light [2] (b) (i) no effect as it lies outside the visible regions/is in the UV / OWTTE (c) rate increases due to more frequent collisions [2] rate of increase slows due to occupancy of active site on enzyme (ii) the colour will be the complementary colour to the colour absorbing at 530nm / it will be red as 530 nm is blue-green / OWTTE [1] Vmax occurs when all active sites are occupied/saturated temperature 13 pH/acidity/basicity presence of metal ions (a) 3 H bonds shown correctly between C and G [2] [2 max] 2 H bonds shown correctly between C and G [1] [2 max] Anthocyanins: water soluble due to their –OH groups, which allow formation of hydrogen bonds with H2O. NH2 Vitamin C: soluble in water due to several –OH groups able to form hydrogen bonds with H2O. [2] (b) Vitamin A will be stored in fat deposits. [1] (c) processed food / cooking destroys vitamins depletion of nutrients in soil and water cultures C N CH C CH HN C C C N CH O (a) Vitamin A: not soluble in water, non-polar molecule. O C Carotenoids: fat soluble due to long non-polar hydrocarbon structure [4] 10 [3] (d) a flatter line which begins at the origin and takes longer to reach Vmax [1] (c) oxidation 9 [2] (b) starch absorbs water and swells, causing plastic to break into small pieces which can be broken down by bacteria [2] (b) phosphate groups negatively charged / anionic attracted to positive electrode (ii) GCCUACUUAGCUA 8 (a) substance foreign to organisms / not naturally found in the environment N H cytosine H2N N N H guanine (b) uracil (pairs with adenine) 2 H bonds shown correctly between UandA OR 2 H bonds shown correctly between T and A [2] lack of education / understanding about balanced diet poor distribution of global resources [3] 75 10:02 Answers O C HN 14 NH2 C CH N C N CH O C CH N H uracil HC C N N H adenine (c) Sequence of three bases representing one amino acid [1] (a) (specific) a particular enzyme can catalyse only one reaction enzyme binds to/reacts with substance / E+S→ ES after reaction product leaves enzyme / EP → E+P mention of active site [4] OWTTE (b) (i) Vmax reduced (ii) Km unchanged [2] 76 10:02