Connect the DNA to Disease

Connect the dots…DNA to DISEASE Introduction Assume the role of a molecular biologist who specializes in protein function. Studying a group of diseased individuals you have discovered that all of the people afflicted with the disease share a gene that others (those without the disease) do not have in their genes. The next step in your research is to transcribe and translate the base sequence to figure out the amino acid sequence of the resulting protein. Afterwards you will enter the sequence of amino acids into a database of proteins to discover the name of the faulty protein that seems to be causing the mysterious malady. Lastly, conduct independent research about the protein to describe the function of the protein and explain why the malformed molecule causes medical problems. Template DNA SEQUENCES Materials (per group) DNA sequence Computer with an internet connection tacgagtgtaagtaccggagactgtcgctccttcttcacacacta tacctacataagtactttcctgaaagtttccggttcctccctcaa tacgcgaaggcgaaaccccaccaccacggtgggcggcaccggccg Procedure 1. Obtain your DNA sequence from your teacher (one of the Template DNA Sequences). 2. Convert your DNA sequence into a complementary mRNA sequence. EXAMPLE: DNA: TACGGCTAG ↓ mRNA: AUGCCGAUC Your DNA sequence: mRNA sequence: Page 1 of 4 tacgtaaccccttgggacacgcctaagaacaccgaaaccgggata tacggataacctaggtttctctccggttgtaaaaaactttaaaaa tactttttatagtaccgacctaacgttgtttggttgtcacttttc tacttccaagacacccgacgcaacgaccagtgtaaggaccgtcct 3. Determine the codons. EXAMPLE: mRNA: Codons: AUGCCGAUC ↓ AUG CCG AUC Codons: ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ 4. Translate the codon sequence into an amino sequence. Use the chart provided. Codons: AUG CCG AUC ↓ Amino Acids: Methionine Proline Isoleucine Amino Acid Sequence: ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ ____________________ 5. Write out the one-letter abbreviations for the amino acids in the sequence. Use the chart provided. ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ Page 2 of 4 9. At the next page, click on the “FORMAT” button. It may take a few minutes to process your sequence. 10. At the next page, scroll down to the list of proteins that matched your sequence. Choose one that matches one on the list of possible proteins that was given to you. 11. The protein our DNA sequence encodes is (should be in the list provided): __________________________________ 12. Now search www.google.com with the name of your protein to find out the disease your protein is involved in. 12. This protein is involved in the following disease: __________________________________ 13. Write a brief paragraph explaining the disease caused by this protein or a mutation in this protein. 14. List 3 things you learned in this activity (either technical concepts, such as using the computer or scientific concepts). (1) (2) (3) Page 3 of 4 AMINO ACID abbreviation AMINO ACID CHARTS AND PROTEIN NAMES Alanine Arginine Asparagine Aspartic acid Cysteine Glutamine Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Possible proteins Presenilin 2 Synuclein Laforin Leptin BRCA 2 Dystrophin Apolipoprotein E Page 4 of 4 A R N D C Q E G H I L K M F P S T W Y V