Capturing HIV-1 Envelope Diversity

Capturing HIV-1 Envelope Diversity: Preventing Recombination in Bulk PCR using Droplet Digital PCR (ddPCR) and Q5 High-Fidelity Polymerase Expensive? LaborRecombination? intensive? Single Genome Amplification (SGA) Yes Bulk PCR with Taq No Yes No 2 No Yes Figure 1. Analysis of current methods for envelope amplification • Our research focuses on testing two new methods, Droplet Digital PCR (ddPCR) and Bulk PCR with Q5 High-Fidelity Polymerase, on their ability to prevent recombination within the envelope. • We predict that these methods will lower recombination frequency. Samples will be sent to be PAC-BIO sequenced. Methods • ddPCR with Taq was done on three cDNA patient samples. • Nested PCR was run on an Agarose Gel Electrophoresis. • PCR products from the 1st cycle were used as template for the 2nd cycle of PCR. Ladder O Plasmid 1 N Plasmid 1 O Plasmid 2 N Plasmid 2 O Plasmid 3 N Plasmid 3 O Plasmid 4 N Plasmid 4 O Plasmid 5 N Plasmid 5 O Plasmid 6 N Plasmid 6 O Plasmid 7 N Plasmid 7 O Plasmid 8 N Plasmid 8 O Plasmid 9 N Plasmid 9 O Plasmid 10 N Plasmid 10 O Plasmid 11 N Plasmid 11 O Plasmid 12 N Plasmid 12 O Pool 1 N Pool 1 O Pool 2 N Pool 2 O Pool 3 N Pool 3 O + Control 1 N + Control 1 O + Control 2 N + Control 2 O – Control N – Control Ladder Figure 4. ddPCR was done on 3 patient samples with two different droplet mixtures (D1: laboratory-made mix, D2: ddPCR-specific mix). Droplets only formed in ddPCR-specific mixture. Bulk PCR was done as control and water was used as the negative control in all variations. Bulk PCR did amplify as expected. Q5 High-Fidelity Polymerase - Expression Plasmid Figure 5. Bulk PCR with Platinum Taq DNA Polymerase was completed to compare sequencing to Bulk PCR with Q5 HighFidelity Polymerase. 12 expression plasmid samples were used with 2 sets of primers (O: ∆ecto + envIF, N: ∆ecto (long) + envIF (short)). Pools were made containing all plasmids. Bulk PCR with Taq amplified all samples except Plasmid 1 (N) and primer pools (N) did not amplify. Bulk PCR with Q5 had large streaking and off-target binding with lack of amplified portions. Q5 High-Fidelity Polymerase (New Primers) - Expression Plasmid + Purified Taq PCR Product (Old Primers) - Expression Plasmid Q5 High-Fidelity Polymerase (New Primers) - Expression Plasmid Figure 6. Certain plasmid samples (1, 3, 4, 5, 7, 10, 12) did not amplify with Q5. Plasmids 2, 6, 8, 9, and 11 amplified. Random Taq samples (5, 6, 11, pool, positive control) were purified in order to detect DNA concentration in spectrophotometry. Ladder N Plasmid 1 Q5 N Plasmid 2 Q5 N Plasmid 3 Q5 N Plasmid 4 Q5 N Plasmid 5 Q5 N Plasmid 6 Q5 N Plasmid 7 Q5 N Plasmid 8 Q5 N Plasmid 9 Q5 N Plasmid 10 Q5 N Plasmid 11 Q5 N Plasmid 12 Q5 N + Control Q5 N – Control Q5 N Pool 1 Q5 N Pool 2 Q5 Ladder Name of Method Platinum Taq DNA Polymerase - Expression Plasmid Ladder N Plasmid 1 O Plasmid 1 N Plasmid 2 O Plasmid 2 N Plasmid 3 O Plasmid 3 N Plasmid 4 O Plasmid 4 N Plasmid 5 O Plasmid 5 N Plasmid 6 O Plasmid 6 N Plasmid 7 O Plasmid 7 N Plasmid 8 O Plasmid 8 N Plasmid 9 O Plasmid 9 N Plasmid 10 O Plasmid 10 N Plasmid 11 O Plasmid 11 N Plasmid 12 O Plasmid 12 N Pool 1 O Pool 1 N Pool 2 O Pool 2 N Pool 3 O Pool 3 N + Control 1 O + Control 1 N + Control 2 O + Control 2 N – Control O – Control Ladder • Conclusions ddPCR with Taq - Patient Samples Ladder cDNA-15 (D1) cDNA-20 (D1) cDNA-28 (D1) Water Control (D1) cDNA-15 (D2) cDNA-20 (D2) cDNA-28 (D2) Water Control (D2) cDNA-15 (Bulk) cDNA-20 (Bulk) cDNA-28 (Bulk) Water Control (Bulk) Blank Ladder • Human Immunodeficiency Virus (HIV-1) is a retrovirus with genetic diversity, especially within the envelope gene. An individual with HIV-1 can harbor multiple variants. Amplification is done to replicate the envelope diversity. Ladder N Plasmid 1 Q5 N Plasmid 2 Q5 N Plasmid 3 Q5 N Plasmid 4 Q5 N Plasmid 5 Q5 N Plasmid 6 Q5 N Plasmid 7 Q5 N Plasmid 8 Q5 N Plasmid 9 Q5 N Plasmid 10 Q5 N Plasmid 11 Q5 N Plasmid 12 Q5 N Pool 1 Q5 N Pool 2 Q5 N Pool 3 Q5 N + Control Q5 N – Control Q5 O Plasmid 5 Purified Taq O Plasmid 6 Purified Taq O Plasmid 11 Purified Taq O + Control Purified Taq O Pool Purified Taq Ladder • Results Introduction Figure 7. Unamplified samples were plasmids 1, 3, 4, 5, 7, 10, 12. This is similar to Figure 6 when comparing Q5 samples. Q5 High-Fidelity Polymerase (New Primers) Temperature Gradient (℃) - Expression Plasmid Platinum Taq DNA Polymerase - Expression Plasmid Ladder O Plasmid 1 Taq O Plasmid 2 Taq O Plasmid 3 Taq O Plasmid 4 Taq O Plasmid 5 Taq O Plasmid 6 Taq O Plasmid 7 Taq O Plasmid 8 Taq O Plasmid 9 Taq O Plasmid 10 Taq O Plasmid 11 Taq O Plasmid 12 Taq O Pool 1 Taq O Pool 2 Taq O Pool 3 Taq O + Control Taq O – Control Taq N Plasmid 1 Taq N Plasmid 2 Taq N Plasmid 3 Taq N Plasmid 4 Taq N Plasmid 5 Taq N Plasmid 6 Taq N Plasmid 7 Taq N Plasmid 8 Taq N Plasmid 9 Taq N Plasmid 10 Taq N Plasmid 11 Taq N Plasmid 12 Taq N Pool 1 Taq N Pool 2 Taq N Pool 3 Taq N + Control Taq N – Control Taq Ladder Ladder P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P3 P4 P3 P4 P3 P4 P3 P4 P3 P4 P3 P4 P3 P4 P3 P4 P5 P6 P5 P6 P5 P6 P5 P6 P5 P6 P5 P6 P5 P6 P5 P6 Ladder 66 65.5 64.5 62.7 60.664.5 58.8 62.7 57.6 60.6 57 58.8 66 57.6 65.5 64.5 60.6 64.5 58.8 62.7 57.6 60.6 57 58.8 66 65.5 60.6 64.5 58.8 62.7 57.660.6 57 58.8 57.6 57 66 65.5 57 62.7 66 65.5 57.6 64.5 57 62.7 66 65.5 Ladder P7 P8 P7 P8 P7 P8 P7 P8 P7 P8 P7 P8 P7 P8 P7 P8 P9 P10 P9 P10 P9 P10 P9 P10 P9 P10 P9 P10 P9 P10 P9 P10 P9 P10 P11 P12 P11 P12 P11 P12 P11 P12 P11 P12 P11 P12 P11 P12 Ladder 66 65.5 64.5 62.7 60.6 58.8 57.6 57 66 65.5 64.5 62.7 60.6 58.8 57.6 57 66 65.5 64.5 62.7 60.6 58.8 57.6 57 Figure 8. Bulk PCR with Q5 was completed at a temperature gradient (57 ℃ - 66 ℃) in order to detect a temperature that matched Q5’s high-sensitivity. Certain plasmids amplified better at lower temperatures (Plasmid 2, 3, 7, 8, 12). Other plasmids amplified at higher temperatures (Plasmid 5, 6, 11). Plasmid 9 worked well and consistently at all temperatures. Plasmid 1 and 10 worked poorly at all temperatures. Figure 3. Amplification of GP120 • Bulk PCR used both expression plasmids and ∆5’ LTR NL43 (Viral Construct) plasmids. • Bulk PCR with Q5 High-Fidelity Polymerase was done with 2 sets of primers. Old (O) ∆ecto + envIF ∆ecto envIF New (N) ∆ecto (long-4) + envIF (short-3) ∆ecto (long-4) envIF (short-3) 5’AAGCCTCCTACTATCATTAT -3’ 5’AGAAAGAGCAGAAGACAGTGGCAAT GA-3’ 5’AACCTACCAAGCCTCCTACTATCATT AT -3’ 5’-GCAGAAGACAGTGGCAATGA-3’ • New primers were used to equalize melting temperatures since Q5 is sensitive to large differences in melting temperature. Future Directions Figure 10. ∆5’ LTR NL43 (Viral Construct) plasmid samples were used in this Q5 PCR. The old primers placed the envelope gene within the plasmid initially which indicates that all primer sets should be able to amplify, considering the new set of primers is edited from the old set. Only plasmids 1, 5, 7, 8, 11, and 12 amplified which does not match the amplified expression plasmids in Figures 5-8. Ladder O Plasmid 1 Taq Blanks O Plasmid 3 Taq Blank O Plasmid 5 Taq O Plasmid 6 Taq O Plasmid 7 Taq O Plasmid 8 Taq O Plasmid 9 Taq O Plasmid 10 Taq O Plasmid 11 Taq O Plasmid 12 Taq O Pool 1 Taq O Pool 2 Taq O + Control Taq O – Control Taq N Plasmid 1 Taq Blanks N Plasmid 3 Taq Blanks N Plasmid 5 Taq N Plasmid 6 Taq N Plasmid 7 Taq N Plasmid 8 Taq N Plasmid 9 Taq N Plasmid 10 Taq N Plasmid 11 Taq N Plasmid 12 Taq N Pool 1 Taq N Pool 2 Taq N + Control Taq N – Control Taq Ladder • ddPCR allowed for amplification of one template strand of DNA that exists in each droplet to reduce recombination. • Agarose Gel Electrophoresis was done to detect target sequences with the correct kB for amplification. Platinum Taq DNA Polymerase ∆5’ LTR NL43 (Viral Construct) Plasmid Q5 High-Fidelity Polymerase (New Primers) ∆5’ LTR NL43 (Viral Construct) Plasmid Ladder N Plasmid 1 Q5 N Plasmid 3 Q5 N Plasmid 5 Q5 N Plasmid 6 Q5 N Plasmid 7 Q5 N Plasmid 8 Q5 N Plasmid 9 Q5 N Plasmid 10 Q5 N Plasmid 11 Q5 N Plasmid 12 Q5 N Pool Q5 N + Control Q5 N – Control Q5 Ladder Figure 2. Demonstrating ddPCR methods Figure 9. Bulk PCR with Platinum Taq was done in order to see if plasmid pools and plasmid 1 with new primers would amplify. Plasmid 1 (N) and plasmid pools (N) did amplify but faint compared to the rest. This PCR went through 35 cycles, so amplification may have occurred previously but not enough to produce band until this run. • Envelope sequences from patient samples did not amplify with ddPCR (Figure 4). • The off-target binding in Figure 5 affirms the annealing temperature necessary for Q5 when compared to Figure 6. • Both Figures 6 and 7 indicate Q5’s inability to amplify certain plasmids. Primers work for Taq which demonstrates that it is not the cause. Q5 uses a premade master mix which reduces variability. • Temperature gradient for Q5 demonstrated that each plasmid best amplified at various temperatures. • Only two plasmids worked poorly under all conditions. • Bulk PCR with Platinum Taq was done to compare with Q5. Figure 9 indicates that Taq works for most samples. • ∆5’ LTR NL43 (Viral Construct) plasmids were used to test if they were better suited for Q5 amplification. However, amplified samples were different compared to expression plasmids. • There is still not an overarching condition that can be used to amplify envelopes for Q5. • Random samples of Taq (N), Taq (O), and Q5 (N) were purified in Figure 12 which indicated that Q5 samples generated more DNA when compared to Taq samples. • Most Taq samples in expression and ∆5’ LTR NL43 plasmids amplified. Plasmids will be matched with Q5 amplified samples and both will be purified. • Purified samples will be sent to be PACBIO sequenced to investigate the rates of recombination and template switching when comparing it to known protocols. • Q5’s high-fidelity is predicted to have lower recombination when compared to Taq. Figure 11. ∆5’ LTR NL43 (Viral Construct) Plasmid Samples were used in this PCR with Taq. All plasmids amplified except Plasmid 3 which does not match the unamplified expression plasmids in Figures 5 and 9. DNA Concentration (ng/𝜇𝐿) of Purified Taq PCR Product (New Primers) DNA Concentration (ng/𝜇𝐿) of Purified Q5 PCR Product (New Primers) DNA Concentration (ng/𝜇𝐿) of Purified Taq PCR Product (Old Primers) Plasmid 5 2.9 Plasmid 5 N/A Plasmid 5 5.3 Plasmid 6 3.2 Plasmid 6 11.4 Plasmid 6 5 Plasmid 11 4.3 Plasmid 11 10.6 Plasmid 11 4.6 Plasmid Pool N/A Plasmid Pool 36.8 Plasmid Pool 13.2 Figure 12. The Purified Taq PCR Product for both sets of primers came from Figure 5 gel and the Purified Q5 PCR Product came from Figure 6 gel. These PCR Products were PCR-cleaned up and purified to remove primers, enzymes, and nucleotides to properly measure DNA concentration through spectrophotometry. All Q5 (N) concentrations were higher than the Taq (N) concentration. Plasmid 5 in Q5 and the plasmid pool in Taq (new) were not done due to the lack of amplification. All of this demonstrates the increased amount of DNA produced with the Q5 enzyme compared to the DNA produced with the Taq enzyme. • SGA will be conducted as a control to compare with Q5 and ddPCR. • We hope to eventually use patient samples (unknown envelope) instead of plasmids. • These results will contribute to future experiments when forming viruses through homologous recombination and testing envelope function and antibody susceptibility. • Neutralizing-resistant antibodies (HIVTuberculosis co-infection) • Maternal-fetal antibodies and vertical transmission of HIV-1