Understanding Genetic Mutations: A POGIL Approach

genetic mutations pogil How many nucleotides are present in the "normal" DNA sequence in Model 1? 4 How many codons are contained in the mRNA that is produced by the "normal" DNA in Model 1? 7 How many amino acids will be in the polypeptide produced by the normal DNA/mRNA sequence? 7 What is the amino acid sequence of the polypeptide produced by the "normal" DNA sequence in Model 1? AUGCAUCAGUGGAUUACCUAG Consider DNA sequence 2 in Model 1. The mutation in that sequence is a substitution mutation. Compare sequence 2 with sequence 1 and describe the mutation that has occurred. What is the effect of this substitution mutation on the amino acid sequence? UGG----- UCG Trp-----Ser Consider DNA sequence 3 in Model 1. The mutation in that sequence is an insertion mutation. Compare sequence 3 with sequence 1 and describe the mutation that has occurred. What is the effect of the insertion mutation on the amino acid sequence as compared to the "normal" amino acid sequence in Model 1? CAG----ACA not the same length different amino acids Consider DNA sequence 4 in Model 1. The mutation in that sequence is a deletion mutation. Compare sequence 4 with sequence 1 and describe the mutation that has occurred. What is the effect of the deletion mutation on the amino acid sequence as it is compared to the "normal" amino acid sequence in Model 1? missing U not the same length different amino acids In your group, use grammatically correct sentences to define each of the following mutations. Substitution mutation— Insertion mutation— Deletion mutation— sub- changes a nucleotide ins- adds a nucleotide del-removes a nucleotide Considering your knowledge of codons and how they code for an amino acid, would all substitu- tion mutations lead to a change in the amino acid sequence? Explain your reasoning. no Would all insertion or deletion mutations lead to a change in the amino acid sequence? Explain your reasoning. yes What could potentially cause more damage (or a greater benefit) to an organism, a substitution mutation or an insertion mutation? Explain your reasoning. insertion What could potentially cause more damage (or a greater benefit) to an organism, a deletion mutation at the beginning of a DNA sequence or at the end of a DNA sequence? the start All of the DNA and mRNA sequences in Model 1 have ellipses (...) on one or both ends of the sequences shown. Propose an explanation for this use of this symbol in that context. the sequence is too long The amino acids produced from sequence 1 and sequence 2 in Model 1 do not have ellipses on the end of them, however the amino acids produced from sequence 3 and sequence 4 do have ellipses. Propose an explanation for the use or absence of the ellipses on these sequences. the sequence changed length For each of the mutations A - D in Model 2, circle the substitution that occurred by comparing the mutated DNA with the original DNA. A)A---U B)C---G C)G---U D)G---C 1/2 As a group, describe the range of changes in the amino acid sequence that can result from this type of mutation. nothing could change (mutation B) or all could change (mutation D) Gene mutations can be positive, negative or neutral. Suppose that the normal gene in Model 2 produced a polypeptide that was necessary for cellular respiration. Choose a mutation from those in Model 2 that would be neutral for a cell. Explain your rea- soning by relating the mutation to the cellular respiration process. Choose a mutation from those in Model 2 that might be positive for a cell. Explain your rea- soning by relating the mutation to the cellular respiration process. Choose a mutation from those in Model 2 that might be negative for a cell. Explain your reasoning by relating the mutation to the cellular respiration process. A) mutation b B)mutation A C) mutation C Which types of mutations, positive, negative or neutral, are most likely to be seen in offspring several generations after the mutation occurred? Explain your reasoning. positive Consider the following scenarios. State whether the mutation is likely to be passed on to the offspring of the organism. Explain your reasoning. A single bacteria cell contains a positive mutation in its DNA. A skin cell on a cat contains a positive mutation in its DNA. A sperm cell in a whale contains a positive mutation in its DNA. A) yes B)only if reproductive cells mutated too C) yes All cells have DNA errors due to the mistakes that occur each time DNA is replicated prior to cell division. There are proofreading enzymes in cells that correct many of these mistakes, but on average, 3 - 5 errors are found in DNA after each replication. If each cell has multiple mutations, why do most of us have normally-functioning tissues and organs? Why is only a tiny subset of these mutations passed on to our children? A) you have so many cells that small mutations are unlikely to harm you B) only mutations that effect the reproductive cells are passed on, this is because of sexual reproduction A gene mutation is a change in the sequence of nucleotides that occurs during cell replication (mitosis and meiosis) within a single coding section of DNA. Mistakes can also occur in the transcription of mRNA or the translation of a polypeptide. However, these genes code for your whole body mRNA only gives instructions to changes are not con- sidered to be mutations, because they are your cells after they are formed. not permanent changes to the cell. Explain why "mis- takes" in transcription or translation are not as serious as mutations in a gene. Insertion and deletion mutations are said to cause shifts in the "reading frame" (the sets of three nucleotides) of the mRNA. Substitution mutations do not cause these so-called frameshifts. Ex- changing the total number of nucleotides shifts the reading frame plain why insertions and deletions are called frameshift mutations, and will make a totally different set of amino acids. using the terms reading frame, codons, and amino acids in your answer. 2/2