PCR Workshop Question of Taste PCR Presentation

PCR Workshop Let’s do a taste test! What are your taste test results? Strong taster • • • Weak taster • Unsure at first, but then find the taste unpleasant • Ratings 1-3 • Non-taster • Quick negative reaction Very bitter Ratings 4-5 Cannot taste anything bitter Rating 0 Record your own result on your sheet What are you tasting? Phenylthiocarbamide PTC is similar to the natural compounds found brussels sprouts PTC only tastes bitter to around 70% of people. To the other 30% it is completely tasteless. What was your phenotype? Why can only some of you taste it? The ability to taste PTC has a genetic basis. What is your genotype? Your phenotype is determined by your genotype. Today, you will see if your genotype matches your phenotype. Genotype = An organism’s unique DNA Phenotype = Observable characteristic of an organism What do we need to see your genotype? Collecting your cheek cells 1. Write your lab number on the cup. 2. Swallow any excess saliva, clean your mouth with your tongue. 3. Gently chew the insides of your cheeks for 1 minute. 4. Swill your mouth with the salt water in the cup for 30 seconds. Don’t swallow it. 5. Gently dribble liquid back into cup. Make sure you only handle your own sample Concentrate your cheek cells 1) Use marker pen to write your lab number on the top and side of a tube 2) Pipette the cell sample into the tube. Make sure you take sample from bottom of cup and fill it to the top line (1.5ml) 3) Close lid and place tube in small white foam rack, one person take it to the centrifuge. Samples will be centrifuged to concentrate cells at bottom of tube Heavier material (the cells) is thrown outwards and collects to form a pellet Centrifuge spins tubes at 14,000 revolutions per minute (rpm) for 2 minutes Liquid (saliva, salt water) Pellet (cheek cells) Discard the liquid 1) Pour most of the liquid back into cup. 2) Place the end of the tube on a tissue (to get out more liquid) 3) Close lid Repeat if there are not enough cells. Create a Cell Suspension (soup) 1) Break up the pellet of cells. 2) The cell suspension should be a cloudy liquid with no lumps. 3) When finished, place tube in your plastic rack. Using Micropipettes- gather your equipment P P20 pipette P200 pipette Tips Practice dye Practice card How to hold a micropipette Micropipette identification 1 - 20 ml 20-200 ml Setting the volume 1 - 20 ml 20-200 ml Let’s practice setting the micropipettes! 1 ml =1000 ml Which pipette would you use to ml? Can you set the pipette for 10 measure 10 ml? Pipette set for 10 ml 1 - 20 ml 20-200 ml 1 the ml = 1000 Can you set pipette Which pipette would youfor useml 30ml? 30 ml? to measure Pipette set for 30 ml 1 - 20 ml 20-200 ml Taking up liquid • • • • Volume control Plunger Put tip on pipette Press plunger down to 1st stop Place tip in liquid Release plunger SLOWLY Dispensing liquid onto card • • • • Place tip where you want liquid to go Press plunger right down to 1st stop (when putting liquid into a tube we use the 2nd stop!) Move tip away from liquid Release plunger Disposable tip Extract DNA from cells 1. Write your number on the lid and side of the screw cap tube containing Chelex beads. 2. Check that micropipette is set to 30µl. 0 3 0 0 3. Place a tip on pipette and cut the end of it at an angle. 30 µl 4. Transfer 30µl of cell suspension from your sample tube to your new screw cap tube. 5. Screw lid down tightly on screw-cap tube, flick it and place in foam rack. 6. One person take it to the vortex and heat sample to break cell membranes and release DNA (100°C for 10 min) What are the beads doing? Chelex beads trap things which might help cut the DNA Chelex beads bind positive metal ions DNA -ve Mn2+ Chelex -ve DNA -ve Cu2+ Chelex -ve Mn2+ Ca2+ Mg2+ Fe2+ Chelex -ve Chelex -ve Cu Chelex -ve 2+ Fe2+ Mg2+ DNA -ve So at the moment… Chelex beads heating Centrifuge to remove used beads and cell debris Today we are looking at the gene TAS2R38 CCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAACTAGAGAAGAGAAGTAGA ATAGCCAATTAGAGAAGTGACATCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTAT GAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACC AATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCAGCCACTGAGCAAC AGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTC CTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTAC CAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGC CTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTG GCAAGCTGGGTCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGC ATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACT GTGCTATTCATGAATAACAATACAAGGCTCAACTGGCAGATTAAAGATCTCAATTTATTT TATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTGGTTTCT TCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGA AACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTT TTCTGCTTCTTTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGCCCCTACTGATTCTG TGGCGCGACAAAATAGGGGTGATGGTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGG CATGCAGCCATCCTGATCTCAGGCAATGCCAAGTTGAGGAGAGCTGTGATGACCATTCTG CTCTGGGCTCAGAGCAGCCTGAAGGTAAGAGCCGACCACAAGGCAGATTCCCGGACACTG TGCTGAGAATGGACATGAAATGAGCTCTTCATTAATACGCCTGTGAGTCTTCATAAATAT GCC This is the gene which encodes for a taste receptor protein that detects PTC Does your tongue have taste receptors for PTC? TAS2R38 taste receptor protein detects PTC This is a single taste bud. Today we’re going to make billions of copies of this part of the gene CCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAACTAGAGAAGAGAAGTAGA ATAGCCAATTAGAGAAGTGACATCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTAT GAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACC AATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCAGCCACTGAGCAAC AGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTC CTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTAC CAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGC CTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTG GCAAGCTGGGTCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGC ATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACT GTGCTATTCATGAATAACAATACAAGGCTCAACTGGCAGATTAAAGATCTCAATTTATTT TATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTGGTTTCT TCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGA AACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTT TTCTGCTTCTTTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGCCCCTACTGATTCTG TGGCGCGACAAAATAGGGGTGATGGTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGG CATGCAGCCATCCTGATCTCAGGCAATGCCAAGTTGAGGAGAGCTGTGATGACCATTCTG CTCTGGGCTCAGAGCAGCCTGAAGGTAAGAGCCGACCACAAGGCAGATTCCCGGACACTG TGCTGAGAATGGACATGAAATGAGCTCTTCATTAATACGCCTGTGAGTCTTCATAAATAT GCC You will use PCR to make many copies of the part of the TAS2R38 gene we want to investigate. How? What are the ingredients for PCR? Setting up PCR reaction Your will each receive a PCR tube containing You will add the final ingredient: your DNA! Setting up PCR reaction 1. Your tiny PCR tube is on ice 2. Write your number on lid and side, then place back on ice 3. Set pipette for 2.5 ml Add 2.5µl of your DNA to the PCR mix – check you have DNA! 2.5 µl Take DNA from top of sample, avoiding the beads Screw-cap tube Centrifuge your tubes Open the centrifuge Put in the tubes, make sure they are balanced! Close the centrifuge and turn on for 30 seconds then turn off Your DNA now goes in the PCR machine The PCR machine is programmed to run through all the required temperatures, and repeats the cycle 35 times A reminder about PCR Recreate the PCR reaction DNA primers nucleotides What have we done so far? Discovered our phenotype via PTC taste test Sampled our own DNA Fe2+ Chelex -ve Burst open the cells and removed impurities from sample Run a PCR to amplify a specific region of the PTC tasting gene What will you do next? Use molecular biology techniques to analyse your DNA Compare the taste test results with your DNA analysis How does the TAS2R38 gene make us a…. Strong taster Weak taster Non-taster A difference in just one nucleotide of TAS2R38 gene Point mutation at nucleotide 145 CCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAACTAGAGAAGAGAAGTAGA ATAGCCAATTAGAGAAGTGACATCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTAT GAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACC AATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGGCCACTGAGCAAC AGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTC CTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTAC CAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGC CTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTG GCAAGCTGGGTCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGC ATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACT GTGCTATTCATGAATAACAATACAAGGCTCAACTGGCAGATTAAAGATCTCAATTTATTT TATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTGGTTTCT TCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGA AACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTT TTCTGCTTCTTTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGCCCCTACTGATTCTG TGGCGCGACAAAATAGGGGTGATGGTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGG CATGCAGCCATCCTGATCTCAGGCAATGCCAAGTTGAGGAGAGCTGTGATGACCATTCTG CTCTGGGCTCAGAGCAGCCTGAAGGTAAGAGCCGACCACAAGGCAGATTCCCGGACACTG TGCTGAGAATGGACATGAAATGAGCTCTTCATTAATACGCCTGTGAGTCTTCATAAATAT GCC A difference in just one nucleotide of TAS2R38 gene Point mutation at nucleotide 145 CCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAACTAGAGAAGAGAAGTAGA ATAGCCAATTAGAGAAGTGACATCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTAT GAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACC AATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGGGCACTGAGCAAC AGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTC CTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTAC CAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGC CTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTG GCAAGCTGGGTCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGC ATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACT GTGCTATTCATGAATAACAATACAAGGCTCAACTGGCAGATTAAAGATCTCAATTTATTT TATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTGGTTTCT TCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGA AACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTT TTCTGCTTCTTTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGCCCCTACTGATTCTG TGGCGCGACAAAATAGGGGTGATGGTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGG CATGCAGCCATCCTGATCTCAGGCAATGCCAAGTTGAGGAGAGCTGTGATGACCATTCTG CTCTGGGCTCAGAGCAGCCTGAAGGTAAGAGCCGACCACAAGGCAGATTCCCGGACACTG TGCTGAGAATGGACATGAAATGAGCTCTTCATTAATACGCCTGTGAGTCTTCATAAATAT GCC How many chromosomes do you have? What do we call different forms of the same gene? Alleles Humans have 23 pairs of chromosomes  We have 2 copies of each gene Alleles are different forms of the same gene Same alleles: Different alleles: Homozygous Heterozygous Alleles can be dominant or recessive Allele for not tasting PTC (t) Allele for tasting PTC (T) Make a prediction… what do you think your genotype is? GENOTYPE Tt Heterozygous TT Homozygous tt Homozygous Strong taster Non-taster PHENOTYPE Weak taster How can we tell if our DNA contains a C or G at position 145? We can use restriction enzymes Restriction enzymes cut the DNA at specific sequences Different restriction enzymes cut different sequences EcoRI GAAT T C C T TAAG PstI CTGCAG GACGTC GAAT T CAC G T C T G CAG C CAAAT G G C GAAT T C CA C T TAAG T G CAGAC G T C G G T T TAC C G C T TAAG G T Which allele with HaeIII cut? Taster GGCC gaggcgg gaggcggccactgagca ccactgagca Non taster gaggcgggcactgagca HaeIII Safety first! Setting up the enzyme reaction 1. Add 10ml of your PCR product to bottom of each tube W 2. To W, Add 5ml water 3. To E, Add 5ml enzyme 10ml from tiny PCR tube E Why do we have no enzyme (water) in one tube? Change pipette tips between tubes! 4. Flick the tubes then centrifuge for about 30 sec and put it in a foam rack. 5. One person take the tubes to the water bath and then incubate at 37°C for 30 minutes How can we tell if the enzyme has cut the DNA? Gel Electrophoresis Gel electrophoresis - Negative electrode Larger DNA fragments move slower Molecules of the same size travel the same distance and form a band Agarose gel + Positive electrode Smaller DNA fragments move faster Group activity GGCC CCGG HaeIII Loading sample on to gel Hold pipette tip just above well, below buffer level Buffer Be careful not to pierce bottom of well with pipette tip! Agarose gel This time you push down to the 1st stop to fill the well with the DNA Have a go! Load 10µl practice dye (tube marked P) to each well. Push down to the 1st stop to fill the well with the DNA Prepare the DNA for analysis 1. Add 2.5µl orange loading dye (tube marked LD) to sample W and E 2. Change the pipette tip for each sample 3. Flick then centrifuge samples (make sure they are balanced) __ ,,,.,. Loading DNA on to gel Samples student 1 Samples student 2 M W E W E 5ml 10ml 10ml 10ml 10ml Gel Note the position of your own samples Which allele with HaeIII cut? Taster GGCC gaggcgg gaggcggccactgagca ccactgagca Non taster gaggcgggcactgagca HaeIII Possible digest results Homozygous non-taster Homozygous taster Heterozygous taster tt TT Tt DNA sequence of interest DNA sequence of interest HaeIII digestion 1 size of DNA fragment HaeIII digestion 2 sizes of DNA fragment 3 sizes of DNA fragment Practice your analysis… 1) What is the phenotype of the tongue? Taster 2) What is the genotype of the tongue? TT or Tt 3) Will the enzyme cut? Yes 4) How many fragments of DNA will there be? If TT then two fragments If Tt then three fragments Possible digest results This is what it will really look like… TT tt Tt (Non-taster) (Taster) (Taster) W E W E W E Marker W – water only (control) E - treated with HaeIII enzyme 383bp 221 bp 121bp 177 bp 44 bp 1 size of fragment Image from Carolina Biological Supply Ltd. 2 sizes of fragment 3 sizes of fragment Primer dimer Safety check! Viewing the DNA A DNA stain was added to the agarose when the gels were made Unexpected results? Phenotype Expected Genotype TT Tt tt Actual Genotype Possible reasons • • High density of taste buds Other genes involved • • • • Low density of taste buds Dry mouth Have a cold Other genes involved • • • • Low density of taste buds Dry mouth Have a cold Other genes involved Tt TT Tt Please write down three words on our wall that describe your experience today! Fun Boring Inspiring Interesting Difficult Dull Informative Rewarding Confusing Thought-provoking Uninteresting Enjoyable Frustrating