University:
Amherst College
Course:
BIOL 330 | Biochemical Principles of Life at the Molecular Level
Academic year:

2009
Views:

496

Pages:

18
Author:

Curtis Welch

Chemical Biology 03! Oct 14, 2009! Central Dogma -II! Hereditary information (genes) is encoded in DNA’s sequence of nucleotides CTAGGGCTCGATCTACTGCTCTAGGATCGCTTGGCTCGACCAGCTGGCCAGCCATGGTCAGCTCGGC How do cells use this information? The DNA never leaves the nucleus. How can DNA dictate a process that happens outside the nucleus? Every cell has the same DNA but only makes a subset of proteins. How does a cell know which DNA information to use? The linear language of DNA is used to dictate the assembly of proteins. How does the cell translate from DNA to protein language? DNA Replication Copies everything RNA Transcription Copies only select bits gene A gene B gene A gene B gene A gene B DNA DNA DNA !"#$ DNA Polymerase copies everything; RNA polymerase does NOT How does RNA polymerase decide which DNA regions to transcribe? Answer: DNA sequences serve as sign posts: start and stop gene B gene A RNA$ promoter sequence DNA RNA$ terminator sequence DNA sequences dictate: WHERE to start transcription WHERE to stop transcription WHICH strand to use as a template$ HOW do they do that?$ Promoter Sequences and Termination Sequences serve as “Recognition Sequences” for Proteins that collaborate with RNA Polymerase. Specific DNA sequence = Specific Protein Binding Site example: eukaryotic TATA-Binding Protein: DNA “Transcription Factors”$ Accessory proteins associate with the promoter sequence (and other sequences) RNA polymerase and other proteins join in to form the “Transcription Initiation Complex” proper position and orientation of RNA polymerase is determined$ Promoters position and orient RNA Polymerase on DNA in front of each gene Orientation determines which strand is the template strand because RNA polymerase can only read a template strand in the 3’ to 5’ direction DNA double helix DNA sequences dictates orientation of Transcription Initiation Complex Because it can only read in the 3’ -> 5’ direction, there is only ONE Possible template strand:$ •rate of RNA polymerization is constant (~30 nte /sec) •BUT frequency of initiation can vary (what might determine that?) Hereditary information (genes) is encoded in DNA’s sequence of nucleotides CTAGGGCTCGATCTACTGCTCTAGGATCGCTTGGCTCGACCAGCTGGCCAGCCATGGTCAGCTCGGC How do cells use this information? The linear language of DNA is used to dictate the assembly of proteins. How does the cell translate from nucleotide to amino acid language? Transcription temporary intermediate (“messenger”) Translation ! sm a l p to cy flow of information in ALL cellular organisms = “the Central Dogma” The GENETIC CODE to Translate from RNA to PROTEIN: triplet code: set of 3 nucleotides (“codon”) encodes 1 amino acid nucleotides! With 3 “letters” to a word, and 4 different letters to choose from, how many possible “words” would this make?$ amino acids! 1960’s : Cracking the Code....$ what amino acid does GAC specify? How about CCG? What is the nucleotide triplet (codon) that specifies arginine? ? ? ? ? ?$ The Genetic Code: (codons in 5’->3’) RNA sequence dictates order of amino acid assembly 3 nucleotides at a time specify one amino acid Amino acid assembly always starts with an AUG Always end with a STOP codon that specifies NO amino acid 5’-A-C-G-U-A-U-G-C-A-U-U-U-G-A-C-G-U-A-A-3’

Chemical Biology 03, 2009 Central Dogma -II

Related Documents

Description

Related Documents

Free up your schedule!

Take 5 seconds to unlock