DNA Base Pairing Activity

DNA Base Pairing There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with T C pairs with G In RNA, A pairs with U, instead of T. Write the complimentary DNA strand for each given strand of DNA. 1. 2. CGTAAGCGCTAATTA GCATTCGCGATTAAT TCTTAAATGATCGATC AGAATTTACTAGCTAG 3. AATGAATAGCTAGCTT TTACTTATCGATCGAA 4. GGCATTCGCGATCATG CCGTAAGCGCTAGTAC 5. CGTTAGCATGCTTCAT GCAATCGTACGAAGTA 6. ACTAACGGTAGCTAGC TGATTGCCATCGATCG Now write the mRNA strand for the given DNA strand. 7. 8. 9. ATGTCGCTGATACTGT mRNA: UACAGCGACUAUGACA GAAGCGATCAGTTACG mRNA: CUUCGCUAGUCAAUGC AATGAATAGCTAGCTT mRNA: UUACUUAUCGAUCGAA 10. GGCATTCGCGATCATG mRNA: CCGUAAGCGCUAGUAC 11. CGTTAGCATGCTTCAT mRNA: GCAAUCGUACGAAGUA 12. ACTAACGGTAGCTAGC mRNA: UGAUUGCCAUCGAUCG Write the tRNA sequence for the given strand of mRNA 13. AGGUCAUGCAUGGGCAUGCAU tRNA: UCCAGUACGUACCCGUACGUA 14. AGAGAUUCAGCUAGCACGAUA tRNA: UCUCUAAGUCGAUCGUGCUAU 15. GUCAUCGAUCGAUCGGAUGCC tRNA: CAGUAGCUAGCUAGCCUACGG 16. UUUCAGUCAGCUAGCGAUCGU tRNA: AAAGUCAGUCGAUCGCUAGCA Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3 base pairs long. 17. AUG CAC UGU CCU UUC GCU GAC mRNA : UAC GUG ACA GGA AAG CGA CUG A. A: Tyr – Val – Thr – Gly – Lys – Arg - Leu 18. GAG AUC UGG UUG GAA UCG mRNA : CUC UAG ACC AAC CUU AGC A. A: Leu – Stop – Thr – Asn – Leu – Ser 19. AGC GUA UUA ACG UAU CAU mRNA : UCG CAU AAU UGC AUA GUA A. A: Ser – His – Asn – Cys – lle – Val 20. AGU CGA UCG AUG CGG AUG AUA mRNA : UCA GCU AGC UAC GCC UAC UAU A. A: Ser – Ala – Ser – Tyr – Ala – Tyr - Tyr 21. GUC GUC GAU AGC UAU CAU GCA mRNA : CAG CAG CUA UCG AUA GUA CGU A. A: Gln – Gln – Leu – Ser – lle – Val – Arg Transcribe the following DNA strand. Then translate the tRNA strand you wrote. 22. TGAGTCGACTGGCTGACCGTAGAC mRNA : ACU CAG CUG ACC GAC UGG CAU CUG tRNA: UGA GUC GAC UGG CUG ACC GUA GAC A. A: Thr – Gln – Leu – Thr – Asp – Trp – His – Leu 23. CTTGGCTTATGGTGGTTCGCTCGC mRNA : GAA CCG AAU ACC ACC AAG CGA GCG tRNA: CUU GGC UUA UGG UGG UUC GCU CGC A. A: Glu – Pro – Asn – Thr – Thr – Lys – Arg – Ala The following are pieces of mRNA. Give the DNA strand from which it was transcribed. 24. 25. GAGAUCUGGUUGGAAUCG DNA: CTCTAGACCAACCTTAGC AGCGUAUUAACGUAUCAU DNA: TCGCATAATTGCATAGTA Complete the table below showing the sequences of DNA, mRNA codons, tRNA anticodons and the amino acids. Remember the genetic code is based on mRNA codons. 1. DNA 1. mRNA codon 4. ACC UGG tRNA anticodon 7. Amino Acid Tryptophan 2. 5. ACC TTC AAG UUC 10. Lysine GAT 6. CUA 8. GAU 11. ATA UAU 9. AUA 12. Leucine Tyrosine Using the following piece of DNA, give the mRNA molecule and the amino acid sequence for which it codes. DNA - A T A T A A A C G A G G A A A T T C C G G G C G UAU AUU UGC UCC UUU AAG GCC CGC mRNA _________________________________________ AUAUAAACG AGGAAAUUCCGGGCG tRNA __________________________________________ Tyr – lle – Cys – Serine – Phe – Lys – Ala - Arg Amino acids ____________________________________ 2. 3. Use the mRNA sequence to find the DNA sequence and the amino acid sequence. TAC GGA TGT ACA CCA CAT TGG AAT DNA __________________________________________ mRNA- A U G CCU ACA UGU GGU GUA ACC UUA UACGGAUGUACACCACAUUGGAAU tRNA __________________________________________ Met – Pro – Thr – Cys – Gly – Val – Thr - Leu Amino acids _____________________________________ For each codon below, give the tRNA anticodon. 3. AAG UUC _______ 4. UAG AUC _______ 5. GGC CCG _______ 6. GCA CGU _______ 7. Give all the possible Anti-codons for the amino acids listed below. GUA, GUG Histidine (His) _________________________________________________ UAA, UAG, UAU Isoleucine (Ile) _________________________________________________ GCA, GCG, GCU, GCC, UCU, UCC Arginine (Arg) _________________________________________________ ACC Tryptophan (Trp) _______________________________________________