Genetics and Inheritance Patterns of Dominance and Gene Expression

2. In snapdragons, heterozygotes have pink flowers whereas homozygous dominant have red flowers and homozygous recessive have white flowers. When plants with red flowers are crossed with plants with pink flowers, what is the expected ratio of red:pink:white in the offspring? --100 3. A woman with type “A” blood and a man with type “B” blood have a daughter with blood type “O” and a son with blood type “B”. IA = the type "A" allele IB = the type "B" allele i = the recessive allele . Which of the following represents the mother’s genotype? —I^Ai 4. Which of the following is true of the son’s genotype?--IBi 5. Which of the following is the correct sequence of events in gene expression? Formation of the primary transcript Regulation of splicing Transport of mRNA from the nucleus to the cytoplasm Translation 6. Individuals who are heterozygous for the Sickle Cell allele contain one normal allele for hemoglobin and one mutant allele for hemoglobin. These individuals are said to have Sickle Cell Trait. As a result, they produce normal hemoglobin as well as sickle cell hemoglobin (in roughly equal amounts). What is this an example of? 7.What amino acid sequence will be generated from the following DNA sequence? 5’ ACCTCACCTCAACCCCATTATA 3’. 8.A mistake occurs during replication of the DNA shown in the previous question and the newly formed DNA has the sequence shown here. 5’ ACCTCACCTCACCCCATTATA 3’—frameshift. What impact, if any, will the mutation have on the protein formed from this region of DNA? You may use the genetic code table in the previous question. 9. Which of the following best describes the initiation of TRANSCRIPTION? --DNA to RNA 10 The pedigree below traces the inheritance of a specific diease. Affected individuals are indicated by filled-in circles (females) and squares (males). Use this pedigree to answer the next two questions. This disease state is caused by a ____________ allele.--recessive 11. The genotype of individual #2 in the previous question must be _____dd_______ 12. A very common type of red/green colorblindness in humans is caused by a mutation in a gene located on the X chromosome. Knowing that the mutant allele is recessive to the wild-type, what is the probability that a boy will be colorblind if his mother is a carrier of the recessive allele and his father is colorblind? XX = female; XY = male.----50% 13. Consider the DNA and mRNA below. The mRNA represents the mature mRNA produced from the transcription of the DNA shown below, and the DNA includes only the coding region of a gene (i.e., only those bases that are transcribed during the formation of mRNA). What is the best explanation for the difference in length between the two? 14.Consider the mutation illustrated below. This represents an example of a:--Silent 15. The diagram below shows a normal chromosome on the left. Letters represent major segments of the chromosomes (perhaps think of the letters as genes). What change has occurred and is illustrated on the right? --Point mutation. -----Inversion 16. Consider Avery’s experiment below. Which treatments (A, B, C) would be able to transform the R (rough) cells into S (smooth) cells? 17. If an organism with the genotype Aa Bb produces gametes, what proportion of the gametes would be AB? Assume the genes are not linked. 18. Based on the Punnett square below, which of the following statements is correct? 19. Meiosis leads to genetic variation in populations. Does “crossing over” and mutations have to occur in order to produce genetic variation? --- leads to the formation of gametes which have half the number of chromosomes in the somatic body cells 20. Use the following cell to answer the next two questions. Which of the following describes the cell below? 21. The cell above has the genotype AaBb. Which of the following best describes the genotypes of gametes formed if hundred of cells identical to the one above underwent meiosis? 22. The image below represents the lac operon. Under what conditions would the lac Z, Y, and A genes be expressed? 23.Below is a description of various mutations that were used to figure out how the lac operon works. Wild type (normal) alleles are indicated by “+”. (I-): mutant repressor protein that does not bind to the operator. (P- ): mutant promoters that are not able to bind RNA polymerase. (OC ): mutant operators that are not able to bind to repressor proteins. (IS ): mutant repressor proteins always bind to the operator, unless the operator is (O C). Use the above information and your understanding of the lactose system to predict lac Z and lac Y expression for the genotype below. ---A 24. In parakeets, two autosomal genes that are located on different chromosomes control the production of feather pigment. Gene B codes for an enzyme that is required for the synthesis of a blue pigment, and gene Y codes for an enzyme required for the synthesis of a yellow pigment. Green results from a mixture of yellow and blue pigments, and recessive mutations that prevent production of either pigment are known for both genes. Suppose that a breeder has two green parakeets and mates them. The offspring are green, blue, yellow, and albino (unpigmented). Let b stand for an allele that produces the absence of blue pigment and y for an allele that produces the absence of yellow. Based on this observation, what is the genotype of the green parents? ---BbYy 25. Which of the following student-drawn Punnett squares shows a correct setup for a MMHh × mmHh cross? 26. Put the following steps of DNA replication in chronological order. 1. Single-stranded binding proteins attach to DNA strands. 2. Hydrogen bonds between base pairs of antiparallel strands are broken. 3. Primase binds to the site of origin. 4. DNA polymerase binds to the template strand. 5. An RNA primer is created. ---(2,1,3,4,5) 27. Two genes interact to determine fur color in Labrador retrievers. If a dog has at least one dominant “E” allele, it will have dark-colored fur. If it is homozygous recessive (ee), the fur will be light-colored (a yellow lab). A different gene- “B” determines whether dark-colored labs will be brown (chocolate) or black. Black labs have at least one dominant “B” while chocolate labs are homozygous recessive (bb). A dog breeder mates two dogs with the following genotypes:eeBb (yellow) x EEBb (black). What proportion of the pups are expected to be yellow?--- There will be 1/4 chance.If the parents are BbEe and bbEe, there is a 1/4 chance they will have a yellow puppy with the ee genotype. 28. The B.1.1.7 Coronavirus Variant (previously referred to as the “UK coronavirus variant) has been a cause for concern. Mutations in this variant have caused it to be more infectious than the original virus responsible for Covid-19, especially mutations in the spike protein gene (the virus uses the spike protein to enter human cells). One mutation- N501Y, is especially worrisome. The name of the mutation comes from the fact that the 501st amino acid has changed from asparagine (abbreviated as “N”) to tyrosine (abbreviated as “Y”). The mutation occurs at the tip of the spike protein and makes this variant bind more tightly to human cells. What type of mutation does N501Y seem to be an example of? Consider the Meselson-Stahl experiment illustrated below for the next two questions. 29.Which of the banding patterns shown below represents the correct predicted banding pattern for Generation 1 of the SEMICONSERVATIVE replication model? 30. Which of the banding patterns shown below represents the correct predicted banding pattern for Generation 2 of the CONSERVATIVE replication model?----B ---C 31. The chromosomes in most of the cells in your body shorten every time cell division (and, therefore, DNA replication) takes place. Fortunately, cells that form sperm and eggs have full-length chromosomes. How is this possible? 32. Which of the following best describes the role of tRNA during gene expression? A cell reads the instructions in DNA and builds a protein-based on those instructions 33. John is homozygous recessive for the earlobe gene and has attached earlobes. Marcia is heterozygous for the earlobe gene and has free earlobes. If John and Marcia mate and have 8 children, what phenotypes (and in what ratios) would be predicted in their children?