MCBG Case Studies Workbook.pdf

Medical Cell Biology & Genetics Worksession 17 Case Studies BACKGROUND The best understood connective tissue disorders are those affecting collagen which is present in virtually all tissues and is the most abundant protein in the body. Along with the proteoglycans, collagen is a major component of the extracellular matrix which surrounds animal cells and provides mechanical strength and rigidity to tissues and organs. There are at least seven major types of collagen that occur in different tissues, each with its own distinctive features although all are composed of a characteristic triple-helical structure with an unusually high content of glycine and proline. Abnormal collagen synthesis or structure causes dysfunction of cardiovascular organs (aortic and arterial aneurisms and heart valve malfunction), bone (fragility and associated deformity), skin (poor healing and unusual dystensibility) and joints (hypermobile joints, arthritis). Defects in any of the essential processes involved in collagen biosynthesis, i.e. abnormal collagen genes, abnormal post-translational modification of collagen, or deficiency of co-factors needed by the enzymes carrying out collagen post-translational modification, lead to structural defects and consequent disease states. The problem A 13-year-old girl presented at her local hospital emergency room with an acute trauma to her left arm. This was sustained after hitting her arm on the banister whilst running down stairs. She reported that she did not hit her arm very hard and was surprised by the pain she felt. She had a history of long-bone fractures but there was no evidence of child abuse. Examination showed that she was a well-developed adolescent female of normal height and no obvious skeletal abnormalities. There were no signs of bruising and no other evidence of trauma to the rest of her body. Head, eyes, ears, nose and throat examination revealed no abnormalities, although her sclerae had a pale blue hue. Her mother was also noted to have pale blue sclerae and she reported that she also suffered occasional fractures. Radiographs of the patient’s left forearm showed a simple transverse fracture. Further radiography of the long bones revealed osteopenia (loss of bone mass) and radiographs of the skull showed mottled areas, suggesting irregular ossification. Question 1. What is your initial diagnosis? osteogenesis Imperfecta The patient’s type I collagen, the principle collagen of bone, was investigated. Fibroblasts were cultured from a skin biopsy and the mature, secreted, type I collagen which they synthesised was analysed by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulphate (SDSPAGE). The Type I collagen triple-helix consists of two1(I) polypeptide chains and one 2(I) chain. In the absence of 2-mercaptoethanol (2-ME), some of the patient's 1(I) chains had an unusually low electrophoretic mobility (high molecular weight) (Fig 1b; band X), whereas in the presence of the reagent, these co-migrated with the normal 1(I) polypeptide chains of the control (Fig 1). ethanol 2 mercepto Figure 1. SDS-PAGE of type I collagen taken from the patient (P) and a healthy control (N). Samples were separated in the presence (a) or absence (b) of the reducing agent 2-mercaptoethanol. Question 2. a) How can you explain the presence of the slow-migrating (high molecular weight) 1(I) chains under non-reducing conditions? T disulfide bondsStillthere So polypeptidechain still exists sohigher molecularweight mutationchanges Cat cus At cysteine so disulfidewill formbetween b) Could you make a prediction about the mutation that is seen in the patient’s collagen? I chains bySNP cysteinegets substituted bisulfite bang form between cysteine cysteine irregular inappropriate disulfidebonds form Question 3. Why do only some of the patient’s 1(I) chains show this abnormal mobility? only mutation in one of the Inhereter from mother nucleus and not theother inmates bby dont Question 4 PCR amplification followed by DNA sequencing confirmed that there was a point mutation in the gene encoding collagen 1(I) (the COL1A1 gene). A comparison of part of the nucleotide sequences (the coding or top strand) of the normal and mutant COL1A1 genes is shown below (the bases involved in the mutation are shown in bold): Normal: CTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAAGGGAG Patient: CTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTTGTTTGGATGGTGCCAAAGGGAG Translate the sequence to predict the effect of the mutation. Remember that no reading frame is specified so you will have to use your knowledge of the collagen molecule to determine which is correct. Normal: CTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAAGGGAG on w no am met asah am ans su en'eseram rev an's am n ay glycan even J aminoaids Patient: CTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTTGTTTGGATGGTGCCAAAGGGAG ay Question 5. How is your prediction supported by the protein electrophoretic data in Fig 1? Question 6. What are the biochemical consequences of this mutation on the structure of the collagen helix? Changes triple helix be INE 1 inappropriate chappropriate divine bond Smallest aminoacid sidemain Cbs is nowtoobig formation disulfide bonds Question 7. The normal sequence contains a TspRI restriction site (5’CAGTGNN) which is highlighted and underlined below. TspRI cuts downstream of the last nucleotide in the recognition sequence. Normal CTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAAGGGAG This 61 bp sequence was amplified by PCR from a normal individual and the patient, digested with the restriction enzyme TspRI and subjected to electrophoresis on an agarose gel. The normal individual gave 2 bands of size 41bp and 20bp as shown on the gel below. Indicate the approximate positions AND intensities of the bands you would expect to see from the patient’s DNA. nutritionsite it won't attaeansmure mutation at ant t 4mm larger If I polypeptide instead of so there are s How does this mutation explain...? a) the blue sclera thin sclera omen collagen allowing underlying dauber choroid insulation 2 patientis heterozygous Question 8. caused by polypeptide stunt total b) the loss of bone mass and the irregular ossification Type I collagen in bones meanercolinsen weaker bones Question 9. The mRNA produced from the COL1A1 gene encodes a protein that is 1464 amino acids in length. Analysis of the 1(I) chains from the patient and normal individuals contains 1057 amino acids. How do you account for this difference? mRNA is immature ha after modification makes itshorter by At cuttingout introns length Signa peptide at off frompepocollagen prowllagern Question 10. The disorder the girl has shows an autosomal dominant inheritance pattern. The girl is the oldest of four children. (a) What can you predict about the girl’s parents and her four grandparents? Draw a simple pedigree of all three generations to help you answer the question. iÉo Do I d Tooo iambs (b) What is the probability that all the girl’s siblings are affected if one of her parents is affected? so chance per mile eraser Og 12 s 0.1 (c) What is theoretical probability that all the girl’s siblings are affected if both parents are affected? mm 0.71 0.427 42.3 (d) Why do you think the actual probability is likely to be lower than the correct answer for section (c)? (HINT: think about the fact this is an autosomal dominant disorder with serious consequences for a structural protein.) Duringembryonic development Could developcomplications and die