Study Guide for Cell Biology Final Part 11

Study Guide for Cell Biology Final 123 Chapter 11: 1. If prokaryotic cells lack chloroplasts, how can some be photosynthetic? a. Chloroplasts only contain two of the many different pigments that exist on earth. Since prokaryotes lack chloroplasts, they simply have different pigments that absorb light energy to then be converted to chemical energy. 2. Describe the structure of a chloroplast. What reactions occur on the thylakoids? In the stroma? a. Chloroplasts have an inner and outer membrane that are separated by an intermembrane space. The inner membrane encloses the stroma. Inside the stroma, they have thylakoids that are arranged in stacks called grana. These are membrane bound sacs that are interconnected and allows for creation of an electrochemical proton gradient between the lumen and the stroma. 3. Write the general equation for photosynthesis in green plants. a. 6CO2 + 6H2O → 6O2 + C6H12O6 4. What substances link the light dependent reactions of photosynthesis? Explain how these two sets of reactions are interdependent. a. These reactions are linked by ATP and NADPH and their oxidized forms. Light dependent reactions rely on the light independent reactions because they need ADP, Pi and NADP+ in order to harvest the solar energy, oxidize water and create ATP and NADPH. The light independent reactions produce ADP, Pi and NADP+ by using the NADPH and ATP that is produced by the light dependent reactions. Basically, the products from one are the reactants of the other. 5. What is a photon? What is wavelength? What are the wavelengths of visible light? What is the relationship between the energy of a photon and its wavelength? a. A photon is how light behaves as a stream of particles. b. Wavelength determines the type of radiation and in the case of visible light, it determines the color of the light. Visible light refers to wavelengths between 400 and 700 nanometers. c. As the energy of a photon increases, the wavelength decreases and as the energy of a photon decreases, the wavelength will increase. 6. Why are some molecules pigmented? Why is grass green? a. Some molecules are pigmented because the pigments they contain absorb every wavelength of visible light EXCEPT the wavelengths that correspond with the color that you are seeing. For example, grass appears green because it contains chlorophyll, which absorbs light at wavelengths between 400-500 and 650-700 nm. These ranges include all colors of light except green, so green is what is reflection and can be seen. 7. Explain what happens when a photon strikes a photosynthetic pigment. Define: excited state, ground state, fluorescence. a. When a photon strikes a photosynthetic pigment, the energy is absorbed from the photon into an electron in the pigment. b. Excited state refers to the electron being transferred to a high-energy orbital from a low-energy orbital. c. Ground state refers to the electron originally being in a low-energy orbital before it is photoexcited by a photon. Study Guide for Cell Biology Final 124 d. Fluorescence is mainly used for measuring compounds in a solution by measuring the absorption with a spectrophotometer. 8. What molecules in chloroplasts are responsible for light absorption? Where are they located? What is an absorption spectrum? a. Chlorophyll a and b molecules are responsible for light absorption in chloroplasts. They are located in the thylakoid membranes. b. An absorption spectrum refers to the chart that is used to measure which light is absorbed at different wavelengths. 9. What are the two groups of accessory pigments? What organisms contain them? What is the role of accessory pigments? a. Carotenoids and phycobilins are the two groups of accessory pigments. b. Red algae contains phycobilins and carotenoids appear in most plants and green algae, but is masked by chlorophyll. c. Accessory pigments increase the range of light wavelengths that can be absorbed. 10. What is a photosystem? What is a reaction center? How is energy passed to a reaction center? How is light energy trapped in a reaction center? What is resonance energy transfer? What is the role of light harvesting complexes? a. A photosystem is the functional unit of light-harvesting complexes that include chlorophyll, accessory proteins, chlorophyll-binding proteins for stabilization, and other proteins that bind components of the electron transport chain. 11. Trace the flow of electrons during photosynthetic energy reduction. What is the final electron acceptor? Where does this process occur? Where does this process occur? 12. Compare and contrast oxidative phosphorylation in mitochondria and photophosphorylation in chloroplasts. Study Guide for Cell Biology Final 125 13. How and at which stage is oxygen produced in photosynthesis? What is the source of the oxygen gas? 14. Define: photolysis, photoexcitation, photophosphorylation. a. Photolysis is the breaking of bonds by light. b. Photoexcitation is the transfer of energy from a photon to an electron is a pigment. c. Photophosphorylation is the synthesis of ATP from ADP and Pi that occurs in a plant using radiant energy absorbed during photosynthesis. 15. Explain how the carriers of the photosynthetic energy reduction reactions are organized on the thylakoid membrane. How is this organization related to proton pumping and the proton gradient produced by electron transport? 16. What are the inputs and outputs of the Calvin cycle? a. Inputs: carbon dioxide, ATP, NADPH b. Outputs: sugar, NADP+, ADP 17. How are ATP and NADPH used in the reactions of the Calvin cycle? a. ATP and NADPH are used to convert the 3-phosphoglycerate molecules into molecules of a 3-carbon sugar called glyceraldehyde-3-phosphate. 18. What molecule receives the carbon dioxide in the Calvin cycle? What 2 molecules are formed directly as a result of this carbon fixation? a. Ribulose-1,5-bisphosphate receives carbon dioxide in carbon fixation. This eventually forms two 3-phosphoglycerate molecules. 19. What is RUBISCO? What is its function in the Calvin cycle? a. RUBISCO stands for ribulose-1,5-bisphosphate carboxylase/oxygenase. RUBISCO catalyzes the attachment of carbon dioxide to ribulose bisphosphate (RuBP), resulting in an unstable 6-carbon molecule. This molecule then splits into two 3-phosphoglycerate molecules that move on to be reduced in the next step. 20. What is the relationship between photosystem I and II? What is the source of electrons for each? a. Photosystem II (PSII) occurs before photosystem I (PSI). PSII excites the electrons first and then the electrons are excited by PSI. Study Guide for Cell Biology Final 126 Chapter 16: 1. What are the general functions of DNA? Outline the Watson-Crick model for DNA structure. Why are A-T and C-G pairs the only ones commonly expected in DNA? What forces hold together the DNA double helix? Which base pairs are held together by 3 hydrogen bonds and which by two? What is the significance of this? Which bases are pyrimidines? Purines? a. DNA generally stores the genetic information needed to make proteins. b. The Watson-Crick model for DNA structures shows that DNA has a double stranded, helical structure. c. One purine binds with one pyrimidine in order to keep the overall diameter of the DNA double helix that same throughout in a distance that still allows DNA to fold into the nucleus. d. The DNA double helix is held together by hydrogen bonds e. The bond between C-G are held together by 3 hydrogen bonds and the bond between A-T are held together by 2 hydrogen bonds f. C and G are pyrimidines and A and T are purines 2. Define the terms complementary and antiparallel. What is meant by the 3’ end and the 5’ end? a. Complementary refers to the base pairs that match with each other. Antiparallel refers to the fact that the two DNA strands run in opposite directions. 3’ refers to the end of the DNA strand that ends with the carbon3 atom facing down and 5’ refers to the DNA strand that has the 5-carbon atom facing down. 3. Compare the structures of B-DNA and Z-DNA. What is the biological significance of these conformations? a. B-DNA has a right-handed helix, naturally occurs, is flexible with sizes and shapes and is the most common form of DNA. b. Z-DNA has a left-handed helix, which causes a zigzag appearance. c. The biological significance of the DNA structures is that it allows the same amount of DNA to be stored as small as possible. 4. What is DNA supercoiling? Compare and contrast negative and positive supercoiling. What is a topoisomerase and how do they work? What is the functional significance of supercoiling? a. DNA supercoiling occurs when the already double helix coils into itself again. This can be a positive or negative supercoil, depending on which way it coils. b. Positive supercoiling is when DNA is coiled following the direction of the double helix and negative supercoiling coils against the double helix. c. A topoisomerase can either inhibit OR induce supercoiling. They work by breaking the DNA strands in various ways, which causes the double helix to fold in order to fix the break in the strands. d. The functional significance of supercoiling is to package the very long DNA strands small enough to fit into the nucleus. 5. Compare DNA denaturation and renaturation. What is the role of temperature in these processes? What is Tm? What is the impact of C-G pairs in the melting temperature? a. DNA denaturation occurs when the DNA strands are separated, which can be induced experimentally by high temperature and/or high pH. Study Guide for Cell Biology Final 127 b. DNA renaturation can occur by slowly lowering the temperature back to the appropriate temperature to allow the hydrogen bonds to reform. c. Tm is known as the DNA melting temperature, which is the temperature at which HALF of the absorbance change is reached. d. C-G pairs increases the absorbance, which in turn increases the Tm value. 6. Define genome. Compare the genomes of a virus, prokaryotic cell, and eukaryotic cell. What is the relationship between genome size and organism complexity? a. A genome is the entirety of an organism’s genes. It consists of the DNA that contains one complete copy of all the genetic information of that organism b. A viral genome can be linear or circular, double or single stranded, and can contain DNA and/or RNA. c. A prokaryotic genome is a circular, double stranded DNA molecule. A linear molecule is very rare. d. A eukaryotic genome is a linear, double stranded DNA molecule and linear, single stranded RNA molecules. They also have many copies of the same gene. e. The larger the genome of an organism, the more complex that organism is in terms of genetics. 7. Describe the structure of the eukaryotic nucleus. a. The eukaryotic nucleus is surrounded by a double membrane with pores to allow transport of proteins and mRNA into and out of the nucleus. 8. Outline the structure of the nuclear envelope. Outline the structure of the pore complexes. a. The nuclear envelope has an inner and an outer membrane with nuclear pores in it. b. Pore complexes have a “basket of fibers”, anchor protein and a spoke. 9. How do the nuclear pores regulate the flow of substances between the nucleus and the cytoplasm? a. Some molecules, like small proteins, can diffuse freely across the nuclear envelope in either direction through an open aqueous channel. Molecules that are too large for this, such as RNA and most other proteins, pass through by an active process that recognizes the molecules and are then selectively transported in one direction. 10. Why is DNA packaging necessary? Compare DNA packaging in eukaryotic and prokaryotic cells. What is a bacterial chromosome? What is a plasmid? Why does DNA bind to histones? Describe the structure of a nucleosome. a. DNA packaging is necessary because it allows the DNA molecule to fold and reduce its size without removing genetic information. This way, the entire molecule can fit inside the nuclear envelope. b. A bacterial chromosome is circular and is located in the nucleoid portion of the cell. c. A plasmid is where the DNA is located in a virus. d. DNA binds to histones because of the opposite charges in order to shorten the molecule to fit inside the nucleus. e. A nucleosome contains a total of 4 dimers, two of them are H2A-H2B and two of them are H3-H4. Study Guide for Cell Biology Final 128 11. Describe the following, their relationship to each other, and their packing info: nucleosome, chromatin fiber, looped domains, heterochromatin, chromosome. What is the packing ratio? a. Nucleosomes are the “beads” along a chain of chromatin that consists of a histone protein and chromatin that’s wrapped around it b. The chromatin fiber is the DNA when it’s bound to the histone proteins c. DNA is only considered to be a “chromosome” when it is condensed and the cell is ready to divide d. Looped domains occur in order to reduce the size of the DNA molecule so it can fit inside the nucleus e. Heterochromatin appears to be more dense because it has more looped domains f. The packing ratio is how the degree to which DNA is condensed is expressed Study Guide for Cell Biology Final 129 Chapters 18 & 19: 1. What is the Central Dogma? Identify the key processes and the main characters. Define transcription and describe its overall steps. What are the building blocks required? What enzyme is responsible for catalyzing the formation of RNA? a. The central dogma includes the processes of transcription and translation. It explains how genetic information is used to synthesize a protein. b. Transcription and translation are the key processes that include RNA polymerase, tRNA and rRNA. c. Transcription is the process of “rewriting” the DNA into mRNA so it can leave the nucleus and be prepared for translation. RNA polymerase binds to the double stranded DNA and separates the two strands. The template strand is used to build the mRNA molecule using the complementary base pair system. RNA polymerase then recreates the hydrogen bonds between the DNA strands and the mRNA strand proceeds to leave the nucleus. d. The building blocks that are required are the nucleotides, including uracil. 2. Define a gene. What is the template? The coding strand? In what direction is the DNA sequence read? a. A gene is the section of DNA that codes for a specific protein. b. The template strand of DNA is the strand that gets used to build the complementary mRNA strand. c. The coding strand is the strand opposite the template that will match the mRNA strand, except with uracil replacing thymine. d. The DNA sequence is read 5’ to 3’. 3. Describe the parts of a promoter in a prokaryotic cell. What sequences does RNA polymerase recognize? What is meant by the terms upstream and downstream with respect to genes? What is the start point? Compare and contrast promoters and RNA polymerases in a prokaryote and eukaryote. What are transcription factors and how do they work? a. RNA polymerase recognizes the TATA box b. Promoter contains the core promoter that binds to the RNA polymerase and the regulatory elements that bind sequence-specific transcription factors c. Upstream is towards the 5’ end and downstream is towards the 3’ end d. The start point is where DNA synthesis begins replication e. Transcription factors are required for RNA polymerase binding to promoters. They work by binding directly to the promoter regions, which can activate or repress the gene’s transcription. 4. Describe the events of binding initiation, elongation and termination of transcription. In what direction is RNA synthesized? What end of the DNA template does the RNA polymerase initiate transcription, 3’ or 5’? a. Translation in eukaryotic cells and prokaryotic cells are very different from each other. In prokaryotic cells, initiation begins with three initiation factors bind to the ribosomes. Then, mRNA and the first tRNA carrying the first amino acid in the sequence bind to the small ribosomal subunit. Finally, the large subunit binds to the small subunit. During elongation, tRNA molecules keep bringing the appropriate amino acids that bind together and form a Study Guide for Cell Biology Final 130 peptide chain. Elongation occurs until a STOP codon appears in the mRNA strand. This is called termination. b. In eukaryotic cells, there are a few more steps added to initiation compared to in prokaryotic cells, but it is overall the same. Elongation occurs the same and so does termination. c. RNA polymerase initiates transcription at the 3’ end of the DNA strand. 5. Below is an mRNA molecule: 5’ AUGCUUAGGCGA 3’ How many amino acids does this code for? Indicate the sequence in the template strand of the DNA molecule from which it was derived. Be sure to indicate the 5’ and 3’ ends. Indicate the sequence in the coding strand of the DNA. a. 4 amino acids b. 5’ TCGCCTAAGCAT 3’ template strand c. 3’ AGCGGATTCGTA 5’ coding strand 6. If this is a strand of DNA: 5’ ATGCCATTGCAACT 3’ Write the complementary, antiparallel strand. a. 3’ TACGGTAACGTTGA 5’ 7. Diagram a mature mRNA molecule and indicate the functions of each major sequence segment. a. 5’ cap. Gene. Poly A tail b. 5’ cap protects from nucleases and positions in ribosome for translation c. Poly A tail protects the mRNA from attack from nucleases d. The gene is what is translated into proteins 8. Diagram the structure of a pre-mRNA molecule. What are introns and exons? a. Intron. Exon. Intron. Exon b. Introns are spliced out c. Exons are kept and bonded together to form mature mRNA 9. Describe three processing steps that occur to convert the initial transcript, pre-mRNA, to mature mRNA. When and where do these processing steps occur? What is the function of the methyl guanine cap and the poly(A) tail? What is a spliceosome? A snRNP? snRNA? What is the significance of introns? What is alternative splicing? Exon shuffling? Study Guide for Cell Biology Final 131 10. Describe the structure of rRNA. What rRNA types are found in each ribosomal subunit in eukaryotes? In prokaryotes? Where are ribosomal subunits assembled? Describe the formation of ribosomal subunits in the nucleolus. Compare prokaryotic and eukaryotic ribosomes. 11. Describe the structure of tRNA molecules. What is a reverse repeat? Where does the amino acid attach? Where is the anticodon? a. Several hairpin loops and a variable loop b. The amino acid attaches to 3’ end of the tRNA by an ester bond c. The anticodon is a sequence furthest away from the AA 12. Describe the process of animoacylation or charging. Where does this occur in the cell? What enzymes are responsible? Why is it important that this process is highly specific? a. First, the AA binds with ATP to form aminoacyl adenylate that bonds with tRNA b. Occurs in cytoplasm c. Uses aminoacyl-tRNA synthetase d. Each tRNA codes for a specific AA. If that is messed up, the AA sequence could be messed up 13. What is the genetic code? How many codons are there? What are the STOP codons? What do the terms degenerate, unambiguous, non-overlapping, and universal mean when describing this code? What is the relationship between DNA triplet, a mRNA codon and a tRNA anticodon? a. How the DNA and RNA bases are translated into amino acids b. 64 different codons c. STOP CODONS: UAA, UAG, UGA d. Universal means this code is used everywhere e. Degenerate means f. Non-overlapping means each codon is completely different g. Triplet matches with a codon and a codon matches with an anticodon 14. Outline the steps of initiation, elongation and termination during translation in prokaryotes. Describe the various states on the ribosome and their functions. Which end of the polypeptide forms first? Study Guide for Cell Biology Final 132 15. What amino acids can replace the amino acid arginine by a single base pair change in DNA? a. Arginine can be coded for by 6 different codons. Those are: CGU, CGC, CGA, CGG, AGA, and AGG. 16. What do you think is the significance of the universality of the genetic code? What does this say about the biological evolution of the system and its ability to change? 17. A DNA molecule has the structure: 3’ 5’ TACGGGAATTAGAGTCGCAGGATC ATGCCCTTAATCTCAGCGTCCTAG 5’ 3’ coding strand template strand The lower strand is the template strand and is transcribed from left to right. Which end would be the 3’ end of the template? What is the amino acid sequence of the protein encoded in this DNA molecule? a. mRNA strand UAC GGG AAU UAG AGA GGA UC b. polypeptide order Ile – Gly – Asn – STOP – Arg – Gly – UC 18. What processes in translation require GTP? a. Initiation and elongation 19. What is the cause of termination of translation? a. The ribosome reaches a STOP codon 20. A chromatographic column in which thymidine polymers (T-T-T-T-T-T-T-T-T-T) are linked to an inert bead is used in separating eukaryotic mRNA from other RNA types. Why? HINT: THINK ABOUT THE STRUCTURE OF mRNA! 21. What could be the consequences of mutations in various regions of the promoter? a. The RNA polymerase may not bond to the promoter, which could cause the gene to not be translated 22. What is the ribozyme? a. A piece of RNA that acts like an enzyme 23. The first codon in an mRNA codes for the amino acid found at the _3’ end_ of the completed polypeptide. a. 5’ end d. 3’ end b. Carboxyl terminus e. amino terminus c. Ribosome Study Guide for Cell Biology Final 133 24. What is the anticodon found on the tRNA that carries the amino acid tryptophan (Trp)? Be sure to designate the 3’ and 5’ ends. a. 3’ ACC 5’ 25. A region of DNA corresponding to a particular prokaryotic gene has the structure shown below: 3’……TTTCCTAGGGCAGGTACATGGACCTTAGTAGGGGGCCTTA……5’ 5’……AAAGGATCCCGTCCATGTACCTGGAATCATCCCCCGGAAT……3’ The gene is transcribed from left to right. The first C in the template strand directs the synthesis of the first nucleotide in the mRNA chain. What is the SECOND amino acid in the protein encoded in this gene? a. 3’UCC5’ Serine? 26. What classes of ribosomes are synthesized on cytoplasmic ribosomes? ER ribosomes? Are the ribosomes different chemically? 27. What is the signal hypothesis? Define: signal sequence. Describe the mechanisms of co-translation import and post-translational import. Provide an example of each type. a. Directs the mRNA polypeptide complex to the RER sequence b. Signal sequences are usually 15-30 amino acids long. Positive charged Nterminus, central hydrophobic region, polar region 28. For the DNA triplet TAG, what is the corresponding codon? What amino acid is coded for? What is the anticodon of the tRNA molecule that delivers this amino acid? a. Codon = AUC b. Amino acid = Ile c. Anticodon = UAC 29. What amino acid would a tRNA carry that has the anticodon 3’AGG5’? a. Serine