Nucleic Acids Affinity Chromatography

Nucleic Acids A. Nucleotides B. Nucleic Acids C. The 4 S’s 1. Size 2. Solubility 3. Shape a. A-DNA b. Z-DNA c. Topology i. Packaging ii. Supercoiling iii. Topoisomerases 4. Stability a. Nucleotides i. Tautomers ii. Acid/base b. Nucleic Acids i. Chemistry ii. Denaturation iii. Stability iv. Nucleases 3. Transformation of hosts 4. Selection of transformants a. b. Selectable marker/gene Distinguish empty plasmids i. Loss of resistance ii. Reporter gene 5. Expression A. B. i. purification C. ii. labeling 6. Site-directed mutagenesis D. E. F. a. Special vectors b. Fusion proteins X X X X X Replication 1. Polymerases 2. Fidelity a.Polymerase recognition b.Exonuclease c.Mis-match repair d.Post-replication repair i. Direct reversal ii. Base excision iii. Nucleotide excision D. Structure of the Information 1. Exceptions to flow 2. Structure 3. Levels of Control E. 3. Sequence determination 4. PCR Recombinant DNA: Biochemical Basis of Biotechnology 1. Restriction enzymes, DNA ligase 2. Vectors and Inserts to make recombinant DNA (rDNA) a. b. Inserts i. cDNA ii. Genomic Vectors Recall: Affinity Chromatography Biotechnology (recombinant DNA technology) has revolutionized protein purification. Basis = function At the level of the DNA sequence, the DNA sequence encoding such binding proteins or ”tags” can be “fused” to the sequence encoding YFP. In this way, a chimeric protein is produced that has the binding function, which allows the use of affinity chromatography. Common “tags” are: Column beads have attached: Maltose-binding protein Maltose Chitin-binding protein Chitin Glutathione-S-transferase (GST) Glutathione (g-Glu-Cys-Gly) His-His-His-His-His-His Ni-chelate ATGCATCATCATCATCATCATATGCCCGCATAT………… TACGTCGTCGTCGTCGTCGTCTACGGGCGTATA………… His FauND I MetProAlaTyr………. 1 Recombinant DNA and Biotechnology Purification of Recombinant Proteins Can you use such an expression system to help visualize proteins INSIDE of cells? Recombinant DNA and Biotechnology Expression • EXAMPLE: Green fluorescent protein, which normally occurs in a jellyfish, emits visible light when exposed to UV light. The gene for this protein has been isolated and incorporated into vectors as a reporter gene araC operator PBAD 2 Recombinant DNA and Biotechnology GFP–Tagged Protein Localization Plasmid -binding protein Glu receptor in round worm Recombinant DNA and Biotechnology GFP–Tagged Protein Localization Plasmid -binding protein Glu receptor in round worm 3 Recombinant DNA and Biotechnology YES! Fluorescence Can Be Used to Determine Protein Location In Vivo • Green fluorescent protein (GFP) • use recombinant DNA technologies to attach GFP to protein of interest • visualize with a fluorescent microscope • Immunofluorescence • tag protein with primary antibody and detect with secondary antibody containing fluorescent tag • Protein can also be fused to a short epitope (e.g., myc-tag [EQKLISEEDL], HA-tag [YPYDVPDYA] or Flag-tag [DYKDDDDK]), and the primary antibody detecting the epitope can be fluorescently labeled. DAPI Example of Flag-tagged Ceramide Synthase, in which an expression plasmid for the fusion protein was transfected into SW480 cells (lymphoma). The counter stains are fluorescent dyes specific for DNA (4',6-diamidino-2-phenylindole, DAPI) and the ER (calreticulin). Recombinant DNA and Biotechnology • Biochemical Basis of Biotechnology - Restriction enzymes, DNA ligase - Vectors and Inserts to make recombinant DNA (rDNA) - Transformation of hosts - Selection of transformants - Expression - Site-directed mutagenesis Make a specific mutation to make a variant protein 4 Recombinant DNA and Biotechnology Site-Directed Mutagenesis Codon(s) for amino acid change ORF A SerPheArgGlyThr A SerPheSerSerThr AGCAGT A Transformation Selection Recombinant DNA and Biotechnology Site-Directed Mutagenesis 5 Recombinant DNA and Biotechnology FUNCTION Biochemistry Genetics PROTEIN GENE rDNA Recombinant DNA and Biotechnology FUNCTION Biochemistry Genetics PROTEIN GENE rDNA 6