Name _______________________________________ Date ______________ Period _______ Worksheet: DNA, RNA, and Protein Synthesis BIOLOGY: Chapter 6-9 Directions: Use your notes and book to answer the following questions concerning Replication, Transcription, and Protein Synthesis. 1. Define the following terms: a. Replication- the act of copying something, almost identical, in dna the first of several steps of DNA based gene expression in which a particular segment of DNA is copied into RNA by the enzyme RNA b. Transcriptionpolymerase c. Translation- translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus 2. Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCGATACGCGGTATCCCAGGGCTAATTUAA 3. If the above code showed the bases on one strand of DNA, what would the complementary strand read? GGC TAT GCG CCA TAG GGT CCC GAT TAA TTT 4. What would the code in problem #2 be transcribed into (What would the mRNA sequence be?) GGC UAU GCG CCA UAG GGU CCC GAU UAA UUU 5. How many codons are there in the above problem? 10 6. What is the three letter sequence on a tRNA molecule called? anticodon 7. How many different amino acids are there that make up all of the proteins in our body? 8. How many different codons are there? 64 20 9. What would the amino acid sequence be translated from the mRNA sequence in problem #4? (Use the Genetic Code table below to translate) gly, tyr, ala, pro, stop, gly, pro, asp, stop, phe. 10. Complete the table below. Use the following DNA sequence. CGGCTATTCGACCCTTACGGTATTGGG DNA triplets CGG CTA TTC mRNA codon GCC GAC CCU GGA UAC ATG GGT GGU CCA TAA ATT GGG UUC CTG TAC CGG CUA GAT AAG GAC CCT tRNA anticodon CCC AUU GGG