Name Class 4th Block Date 4/22/21 Skills Lab Chapter 13 Lab From DNA to Protein Synthesis Problem What are the steps involved in making a protein? Introduction Before a protein can be built, the biochemical blueprints for its construction must be packaged and transferred out of the DNA “library.” First, the specific sequence of DNA that codes for the protein is transcribed into a complementary strand of mRNA. In eukaryotic cells, the mRNA then leaves the nucleus and enters the cytoplasm. In all cells, the mRNA molecule attaches to a ribosome, where tRNA anticodons translate the mRNA into amino acids. The completed amino acid chain, or polypeptide, then folds into its final shape as a protein. In this lab, you will model transcription of DNA and translation of mRNA while you decode secret messages. Skills Focus Use Models, Sequence Pre-Lab Questions 1. Sequence Describe briefly the process you will use to decode the messages. It is called Transcription and it will use ribosomes to decode the DNA to mRNA. 2. Compare and Contrast What role do stop codons play in protein synthesis? What are they used for in the coded messages? Uses amino acids and allows the "languages" of the different bio matter to be understood and read by all of the other pieces of bio matter . 3. Predict Which six letters will not appear in the coded messages? Give a reason for your answer. B J O U and Y because they could improperly bind with others. Procedure Part A: How to Decode Messages 1. Write the complementary mRNA strand for the DNA sequence given below by finding the mRNA codon that matches each DNA triplet, base for base. The mRNA strand has been started for you. Finish the transcription. DNA: TAC CGT TTT CTT ATT TAC ATA ACT CTG CGA ATG mRNA: AUG GCA AAA GAA UAA 2. Use Figure 1 to match each mRNA codon from Step 1 with its corresponding amino acid. When the codon is a “stop” codon, include “stop” in the sequence. The amino acid sequence has been started for you. Finish the translation. methionine, alanine, lysine, glutamic acid, stop, Figure 1 Map of mRNA codons to amino acids 3. Use the table to find the single-letter symbol for each amino acid in the sequence from Step 2. The symbols will spell out a sentence or a familiar saying. The first word has been done for you. MAKE AUG GCA AAG GAG UGA Single-Letter Symbols for Amino Acids Symbol Amino Acid Amino Acid A Alanine Arginine R Asparagine Symbol Leucine L Lysine N K Methionine M F Aspartic Acid D Phenylalanine Cysteine C Proline P Glutamic Acid E Serine S Glutamine Q Threonine T Glycine G Tryptophan W Histadine H Tyrosine Y Isoleucine I Valine V Part B: Decoding Messages 4. Use the procedure from Part A to decode the following messages. Remember to transcribe the DNA messages into mRNA codons and then translate the codons into amino acids. a. TGA CGA TTT CTC ACT ACA CGC GCG CTT ACU GCU AAA GAG UGA UGU GCG CGC GAA b. GTA CTT ATT TAA AGC ATC CGT ATT AGT GGC ATA CAU GAA UAA AUU UCG UAG GCA UAA UCA CCG UAU c. TAC CTC CTT TGA ATT TAC CTT ACT CGT TGT ATT AAA TAT CAG CTC AUG GAG GAA ACU UAA AUG GAA UGA GCA ACA UAA UUU AUA GUC GAG d. TGT GTA CTT ACT GGG GAT CGC TTG ATT GTA CGG AGC ATC ACG GTG CGA TTG CCC CTT CTG ACACAUGAAUGACCCCUAGCGAACUAAACUAGCGAACUAACAUGCCUCGUAGUGCCACGCUAACGGGGAAGAC e. TGT GTG CTC ACT AGA GTA TAG GGA ATT AGG CGG TAT GAC AGC ATC CGA TGC ACT CTG CGC ACC TTA ACACACGAGUGAUCUCAUAUCCCUUAAUCCGCCAUACUGUCGUAGGCUACGUGAGACGCGUGGAAU Analyze and Conclude 1. Apply Concepts How did you know which bases to use when you transcribed the DNA sequence to mRNA codons? I knew because of the bases i saw connected to them on the wheel. 2. Predict Suppose the DNA sequence for the first message in Part B began with TGT CGA instead of TGA CGA. Would the message change? Why or why not? No because both of the changed messages still are in the same realm and aren't completely changed from the codon to a new one, they will keep the old one. 3. Use Analogies Suppose some codons mapped to two different amino acids? What would the effect be on your translation of coded messages? What would the effect be on the production of proteins? 4. Sequence During the actual production of proteins in a cell, what might happen to a strand of RNA before it leaves the nucleus? 5. Evaluate and Revise What step could you add after you transcribe the DNA to make a more complete model of protein synthesis? Extend Your Inquiry Create your own secret message using DNA triplets. Exchange messages with classmates and try to solve the messages you receive. Remember that there is no triplet for the letters B, J, O, U, X, and Z. You will need to be creative to come up with messages that don’t use those letters.