History of The Theory of Evolution Part 2

Post-zygotic Isolating Mechanisms Post-zygotic isolating mechanisms--mechanisms which act after fertilization to prevent successful inter-population/species production of viable offspring. A. Reduced Hybrid Viability – The hybrid organism can’t survive for long during development. B. Reduced Hybrid Fertility – The hybrid organism survives, it just can’t reproduce. Evidence for Evolution Phylogeny or Phylogenetics—The evolutionary history of a species. Homologous features/homologies—structures in different species that are similar because of common ancestry (arm of a human, wing of bat, flipper of a whale). These structures have the SAME STRUCTURE because the DNA “blueprint” is the same. Shared DNA/RNA/Protein Structure is the ultimate homology. The similarity of DNA sequences is the most compelling evidence that scientists have to prove the evolutionary relationships between organisms. Analogous features—Similarity in two species due to convergent evolution rather than to descent from a common ancestor (wing of bird and wing of a mosquito). Does not imply common ancestry. Indicates different solutions to the same evolutionary problem. Vestigial organ—A structure that is a historical/evolutionary remnant of a structure that was important in evolutionary ancestors (appendix in humans, pelvis in a whale). Since snakes have a vestigial pelvis, scientists think they evolved from a lizard ancestor. Fossil Record—The fish/amphibian/reptile/bird/mammal fossil pattern found in rock strata over the entire Earth is evidence that the different types of vertebrates evolved in that order. Comparative Embryology--the study of the similarities and differences among various organisms during the embryologic period of development. Organisms with more similar embryonic development patterns are more related than those with different patterns. Comparative Biochemistry and Molecular Biology—Comparing the DNA, RNA, Protein Structures, and metabolic pathways of related organisms. Organisms who share these characteristics must have inherited them from a common ancestor. Artificial Selection—evolution brought about by selective breeding (examples: dog breeds, crop plants). Man-made evolution—Works much faster than natural evolution. The argument is that if humans can make evolution happen, so can nature. Direct Observation of Microevolution—Development of antibiotic and pesticide resistance have been witnessed within the last 75 years. Biogeography--The geographic distribution of organisms on Earth follows patterns that are best explained by evolution, in combination with the movement of tectonic plates over geological time. For example, broad groupings of organisms that had already evolved before the breakup of the supercontinent Pangaea (about 200 million years ago) tend to be distributed worldwide. In contrast, broad groupings that evolved after the breakup tend to appear uniquely in smaller regions of Earth. For instance, there are unique groups of plants and animals on northern and southern continents that can be traced to the split of Pangaea into two supercontinents (Laurasia in the north, Gondwana in the south). The evolution of unique species on islands is another example of how evolution and geography intersect. For instance, most of the mammal species in Australia are marsupials (carry young in a pouch), while most mammal species elsewhere in the world are placental (nourish young through a placenta). Australia’s marsupial species are very diverse and fill a wide range of ecological roles. Because Australia was isolated by water for millions of years, these species were able to evolve without competition from (or exchange with) mammal species elsewhere in the world. Patterns of Evolution Gradualism--Gradualism is selection and variation that happens gradually. Over a short period of time it is hard to notice. Small variations that fit an organism slightly better to its environment are selected for: a few more individuals with more of the helpful trait survive, and a few more with less of the helpful trait die. Very gradually, over a long time, the population changes. Change is slow,constant, and consistent. Punctuated Equilibrium--In punctuated equilibrium, change comes in spurts. There is a period of very little change, and then one or a few huge changes occur, often through mutations in the genes of a few individuals. Punctuated equilibrium can also occur due to sudden/cataclysmic changes in the environment that result in more rapid changes in the organisms through harsher selection. Phylogenetic Relationships/Shared Ancestry • Phylogeny--The history of the evolution of a species or group, especially in reference to lines of descent and relationships among broad groups of organisms. • Ways to establish phylogenetic relationships between organisms: • Compare DNA/RNA sequences of specific genes. The more similar the sequences, the more recently the organisms shared a common ancestor. • Compare the amino acid sequences of specific proteins. The more similar the sequences, the more similar the DNA/genes, the more recently the organisms shared a common ancestor. • Compare morphology/shared derived traits. The more traits the organisms share, the more recently they shared a common ancestor. Methods Used to Depict Phylogenetic Relationships • Phylogenetic Tree--A branching treelike diagram used to illustrate evolutionary (phylogenetic) relationships among organisms. Each node, or point of divergence, has two branching lines of descendance, indicating evolutionary divergence from a common ancestor. A phylogenetic tree is drawn like a branching tree diagram in which branch length is proportional to the evolutionary distance/time between organisms. This is not true in a cladogram. Cladograms do not indicate time. Branch lengths are typically all the same length in a cladogram. • Cladogram--A branching treelike diagram used to illustrate evolutionary (phylogenetic) relationships among organisms. Each node, or point of divergence, has two branching lines of descendance, indicating evolutionary divergence from a common ancestor. A cladogram is a type of phylogenetic tree. Important Terms to Know • Clade--a group of biological taxa (such as species) that includes all descendants of one common ancestor. • Root--The initial ancestor common to all organisms within the cladogram. This is the point which begins the cladogram. • Morphology--a branch of biology dealing with the study of the form and structure of organisms and their specific structural features. • Ancestral Trait--a trait shared by a group of organisms as a result of descent from a common ancestor. • Derived Trait--a trait that is present in an organism, but was absent in the last common ancestor of the group being considered. • Outgroup—An outgroup is a group of organisms that serves as a reference group when determining the evolutionary relationships of the ingroup, the set of organisms under study. The chosen outgroup is hypothesized to be less closely related to the ingroup than the ingroup is related to itself. The evolutionary conclusion from these relationships is that the outgroup species has a common ancestor with the ingroup that is older than the common ancestor of the ingroup. • Node-- Each node corresponds to a hypothetical common ancestor that speciated to give rise to two (or more) daughter taxa. Cladograms can be rotated around each node without changing the meaning/relationships depicted by the cladogram. • Clade/Monophyletic Group-- A common ancestor and all of its descendants (i.e. a node and all of its connected branches) Constructing a Cladogram Based on Morphology • Begin by constructing a character table like the one included on the proceeding slide. In the table use a “1” to indicate that an organism possesses a trait and a “0” to indicate that an organism does not possess the trait. • The trait possessed by all of the organisms is the ancestral trait. Character Table Constructing a Cladogram Based on Morphology • Step 1: Draw a single right slanted line from the bottom left corner of your paper toward the top right-hand corner of the page. At the top of the line, list the most complex group of organisms. This organism should possess more of the shared derived traits than any of the other organisms. This line will be the main evolutionary pathway or line. • Step 2: Determine the first outgroup. This is the most primitive (oldest) group of organisms. It will share only one of the traits (the ancestral trait) with the other taxa (clades) and therefore will be your first outgroup. Just up from the root ofyour cladogram (bottom left corner) draw a left slanted line off of the main line. At the top of the line write the name of the taxon of your first outgroup. • Step 3: Just below and to the left of the outgroup line, draw a short horizontal line across the main line. At the end of this small line, write the name of the ancestral trait, the trait shared by all of the organisms in the cladogram. • Step 4: Just above the outgroup line, draw a left slanted line that will show the next most primitive group or second outgroup. List the group name at the endof the line. This group should possess only the ancestral trait and one additional shared derived trait. These and all the other organisms that evolved later are referred to as the ingroup . • Step 4: Between the first outgroup line and the line drawn in Step 4, draw a small horizontal line across the main line. At the right end of the small line, write the name of the shared derived trait that separates the first outgroup from the first taxa in the ingroup. • Step 6: Looking at the character table, decide the next group of organisms to become the next outgroup each time. Draw another left leaning line for them and list their name at the end of the line. Be sure to use horizontal lines across the main line to indicate the traits which separate the outgroups. Only traits shared by all of the organisms above and to the right of the indicated line should be included on the main line. • Step 7: Repeat until all groups of organisms have been listed or branched off of the main evolutionary line. • Step 8: If you have two groups of organisms in the same outgroup, draw one left leaning line for the group. Have a second right leaning line branching off of this left leaning line. On this second right leaning line, draw a small horizontal line and list the separating trait here. (Just as you did on the main line.) Using Molecular Evidence to Create Cladograms • All organisms use DNA and RNA as genetic material and the genetic code by which proteins are synthesized is (almost) universal. • This shared molecular heritage means that nitrogenous base and amino acid sequences can be compared to ascertain levels of relatedness. • Over the course of millions of years, mutations will accumulate within any given segment of DNA. • The number of differences between comparable base sequences demonstrates the degree of evolutionary divergence. • A greater number of differences between comparable base sequences suggests more time has passed since two species diverged, • Hence, the more similar the base sequences of two species are, the more closely related the two species are expected to be. • When comparing molecular sequences, scientists may use non-coding DNA, gene sequences or amino acid sequences. • Non-coding DNA provides the best means of comparison as mutations will occur more readily in these sequences. • Gene sequences mutate at a slower rate, as changes to base sequences may potentially affect protein structure and function. • Amino acid sequences may also be used for comparison, but will have the slowest rate of change due to codon degeneracy. • Amino acid sequences are typically used to compare distantly related species (i.e. different taxa), while DNA or RNA base sequences are often used to compare closely related organisms (e.g. different haplogroups – such as various human ethnic groups) Using DNA sequence comparisons to construct a cladogram The table included below contains the DNA sequences from the same gene from five related species. Calculate the percent similarity of the sequences of species B-E compared to species A. Use this information to create a cladogram. Place species A at the top right hand corner of our cladogram. Species DNA SEQUENCE PERCENT SIMILARITY TO SPECIES A A ATGACGCGGTGTACGACCAG 100% B ATGAGGCGGTGCCCGACCCT C ATGAGGCGGTGTACGACCAG D GGGAGGCGGTGCCCGACCCT E ATGAGGCGGTGCCCGACCAG