Genetics Practice Exam

Biol 3301: Genetics Exam #2 This exam consists of 28 questions worth a total of 100 points. The point total for each question is shown in parenthesis. Partial credit can be earned, so show your work. Good luck. Name____________________________________ SS#_____________________________________ NOTE: THIS EXAM ALSO COVERED MICROBIAL GENETICS, SO THOSE QUESTIONS HAVE BEEN REMOVED. 1. (3) The molecule shown at the right is a ______a________. a) Purine ribonucleotide monophosphate b) Pyrimidine deoxynucleotide monophosphate c) Pyrimidine dideoxynucleotide monophosphate d) Purine deoxynucleotide monophosphate e) Pyrimidine ribonucleotide monophosphate PO3 – CH2 H H OH 0 H H OH 2. (3) If a piece of double stranded DNA has an guanine content of 26%, what proportion of thymine do you expect? a) 24% b) 25% c) 26% d) 0% e) 48% Answer - a 3. (6) During the initiation of DNA synthesis, helicase __unwinds____ the double strand DNA helix, SSBP maintains unwound DNA in a ____single-stranded____ form, and primase lays down __RNA___ primers used to initiate DNA synthesis. 4. (6) Weak base pairing is seen between __Adenine__ and ____Thymine_____ because only ___2______ hydrogen bonds are formed, whereas strong base pairing is seen between ___cytosine___ and ______guanine_______ because ____3______ hydrogen bonds are formed. 5. (4) A ß-pleated sheet is an example of a: a) Alternative DNA structure b) Protein tertiary structure d) Protein secondary structure e) Mutant ß-galactosidase protein 6. (3) Two amino acids are shown below. Draw what they would like after being joined by a peptide bond. H R1 | | H – N – C – C – OH + | || H O 7. (3) H R2 | | H – N – C – C – OH = | || H O Answer - d c) Mutant ß-globin protein H R1 H R2 | | | | H – N – C – C – N – C – C – OH | || | || H O H O During mRNA splicing, a 2’-5’ bond is formed between which two nucleotides? a) G and C b) G and T c) G and U d) G and A e) U and A 1 Answer - d 8. (3) In eukaryotes, the class of RNA that is translated is called __mRNA__, which is transcribed exclusively by RNA polymerase _____II______. 9. (3) The following DNA fragment contains a gene’s translation initiation codon. Translation start __↓_ 3’ GCGGTGTAACTATAA 5’ 5’ CGCCACATTGATATT 3’  template strand The orientation of the template strand for mRNA synthesis must be: a) upper strand, 5’  3’ orientation b) lower strand, 3’  5’ orientation c) lower strand, 5’  3’ orientation d) upper strand, 3’  5’ orientation e) none of the above. Answer - c 10. (4) If the AAUAAA sequence is removed from a eukaryotic mRNA, which event will not occur? a) 5’ cap addition Answer - b b) Cleavage and poly-adenylation of the mRNA c) Splicing of introns d) Transport to the cytoplasm e) None of the above Answer - c 11. (3) A tRNA with the anticodon 5’ UCG 3’ would base pair with which codon(s)? a) 5’ AGC 3’ and 5’ AGU 3’ b) 5’ AGC 3’ only c) 5’ CGA 3’ and 5’ CGG 3’ d) 5’ CGA 3’ only e) 5’ CGA 3’, 5’ CGI 3’ and 5’ CGG 3’ 12. (3) If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? ____.____.___.____.____.____.____.___.____.____.____.___.____.____.stop 5’UCAGGAGGUUAUGGACCAUUGCUGGGACCUUUACAUGCUGUACCAUAGUUCAUGAUAGCCAUG3’ a) 16 b) 14 c) 10 d) 13 e) 7 Answer - b 13. (3) State the name of processes 1, 2 and 3 denoted below. 2 DNA 3 RNA Protein 1) replication 2) transcription 3) translation 1 14. (4) What is the function of EF-Tu during translation in prokaryotes? a) Brings N-formylmethionine-tRNA to the ribosome P site. b) Releases EF-Ts from the ribosome c) Brings aminoacyl tRNAs to the ribosome A site d) Binds to stop codons in the ribosome A site e) Causes the formation of a peptide bond during elongation 15. (3) ß-galactosidase converts: a) lactose to two glucose molecules d) lactose to glucose and galactose Answer - c Answer - d b) Glucose to galactose c) Galactose to lactose e) Galactose to glucose and lactose 2 16. (3) A partial diploid of genotype I- P+ O+ Z+ Y-/ I+ P+ O+ Z- Y+ will show: a) Inducible production of ß-galactosidase and permease. b) Constant expression of ß-galactosidase and inducible expression of permease c) Constant expression of ß-galactosidase and permease. d) No production of ß-galactosidase and inducible permease. e) Constant expression of ß-galactosidase and no expression of permease. Answer - a 17. (4) In the trp operon, high levels of tryptophan lead to base pairing between RNA segments __3 and 4___ in the leader sequence. This base pairing results in the __termination__ of transcription. 18. (3) Label the regulatory elements A and B in the eukaryotic gene below. +1bp A B -2000bp -30bp a) enhancer or silencer b) TATA box or promoter 19. (3) A transcriptional activator binds to the sequence TAAGGTACCTTA as a dimer. Which functional domains must this protein contain? Must contain a DNA binding domain (it binds to DNA), a activation domain (it activates transcription) and a dimerization domain (it binds as a dimmer). 3