Recitation Section 8 Answer Key: Molecular Biology - Transcription and Translation

Recitation Section 8 Molecular Biology—Transcription and Translation Today we return to take another look at the yeast cystathionine beta synthase (CBS) protein. Below is the sequence of the yeast CBS gene and surrounding DNA. We will use this sequence for parts A and B of today’s section. The sequences of both strands of the DNA duplex are shown: the top strand reads 5' to 3' left to right (1 to 2040); the bottom, complimentary, strand reads 5' to 3' right to left (2040 to 1). 5’- CAACTTCACCCAAGTAAGGATAATCAGCTCTGTCGTGACTGATAAATGCTATATCCGGCA 1 ---------+---------+---------+---------+---------+---------+ 3’- GTTGAAGTGGGTTCATTCCTATTAGTCGAGACAGCACTGACTATTTACGATATAGGCCGT TATGCAGTCCACACGGCATTACCGTTTCACTAATTTATTGCCATCTTCCTCCACAGTTTT 61 ---------+---------+---------+---------+---------+---------+ ATACGTCAGGTGTGCCGTAATGGCAAAGTGATTAAATAACGGTAGAAGGAGGTGTCAAAA GCACCGAAAGGAAAAAAAGAAACCAACACCGAAAATTTTTTTCTCCTAAAGGTTAAAGTA 121 ---------+---------+---------+---------+---------+---------+ CGTGGCTTTCCTTTTTTTCTTTGGTTGTGGCTTTTAAAAAAAGAGGATTTCCAATTTCAT AACGCAAGGCACTTCACCAGGCTTGTATATATAAATGTCGTGATGCTTCTATGCCAAAGT 181 ---------+---------+---------+---------+---------+---------+ TTGCGTTCCGTGAAGTGGTCCGAACATATATATTTACAGCACTACGAACATACGGTTTCA AAAAGGCAACACTTGAAGATTTCGTTGTAGGCCACTTGCTCAAAGGACATCTAGATAAAT 241 ---------+---------+---------+---------+---------+---------+ TTTTCCGTTGTGAACTTCTAAAGCAACATCCGGTGAACGAGTTTCCTGTAGATCTATTTA ACGACGTAAGAATAAAAATGACTAAATCTGAGCAGCAAGCCGATTCAAGACATAACGTTA 301 ---------+---------+--------c+--------b+---------+---a-----+ TGCTGCATTCTTATTTTTACTGATTTAGACTCGTCGTTCGGCTAAGTTCTGTATTGCAAT TCGACTTAGTTGGTAACACCCCATTGATCGCACTGAAAAAATTGCCTAAGGCTTTGGGTA 361 ---------+----e----+--d------+---------+---------+---------+ AGCTCAATCAACCATTGTGGGGTAACTAGCGTGACTTTTTTAACGGATTCCGAAACCCAT TCAAACCACAAATTTATGCTAAGCTGGAACTATACAATCCAGGTGGTTCCATCAAAGACA 421 ---------+---------+---------+---------+---------+---------+ AGTTTGGTGTTTAAATACGATTCGACCTTGATATGTTAGGTCCACCAAGGTAGTTTCTGT GAATTGCCAAGTCTATGGTGGAAGAAGCTGAAGCTTCCGGTAGAATTCATCCTTCCAGAT 481 ---------+---------+---------+---------+---------+---------+ CTTAACGGTTCAGATACCACCTTCTTCGACTTCGAAGGCCATCTTAAGTAGGAAGGTCTA CTACTCTGATCGAACCTACTTCTGGTAACACCGGTATCGGTCTAGCTTTAATCGGCGCCA 541 ---------+---------+---------+---------+---------+---------+ GATGAGACTAGCTTGGATGAAGACCATTGTGGCCATAGCCAGATCGAAATTAGCCGCGGT TCAAAGGTTACAGAACTATCATCACCTTGCCGGAAAAAATGTCTAACGAGAAAGTTTCTG 601 ---------+---------+---------+---------+---------+---------+ AGTTTCCAATGTCTTGATAGTAGTGGAACGGCCTTTTTTACAGATTGCTCTTTCAAAGAC TCCTAAAGGCTCTGGGTGCTGAAATCATCAGAACTCCAACTGCTGCTGCCTGGGATTCTC 661 ---------+---------+---------+---------+---------+---------+ AGGATTTCCGAGACCCACGACTTTAGTAGTCTTGAGGTTGACGACGACGGACCCTAAGAG CAGAATCACATATTGGTGTTGCTAAGAAGTTGGAAAAAGAGATTCCTGGTGCTGTTATAC 721 ---------+---------+---------+---------+---------+---------+ GTCTTAGTGTATAACCACAACGATTCTTCAACCTTTTTCTCTAAGGACCACGACAATATG TTGACCAATATAACAATATGATGAACCCAGAAGCTCATTACTTTGGTACTGGTCGCGAAA 781 ---------+---------+---------+---------+---------+---------+ AACTGGTTATATTGTTATACTACTTGGGTCTTCGAGTAATGAAACCATGACCAGCGCTTT TCCAAAGACAGCTAGAAGACTTGAATTTATTTGATAATCTACGCGCTGTTGTTGCTGGTG 841 ---------+---------+---------+---------+---------+---------+ AGGTTTCTGTCGATCTTCTGAAGTTAAATAAAGTATTAGATGCGCGACAACAACGACCAC CTGGTACTGGTGGGACTATTAGCGGTATTTCCAAGTACTTGAAAGAACAGAATGATAAGA 901 ---------+---------+---------+---------+---------+---------+ GACCATGACCACCCTGATAATCGCCATAAAGGTTCATGAACTTTCTTGTCTTACTATTCT TCCAAATCGTTGGTGCTGACCCATTCGGTTCAATTTTAGCCCAACCTGAAAACTTGAATA 961 ---------f---------+---------+---------+---------+---------+ AGGTTTAGCAACCACGACTGGGTAAGCCAAGTTAAAATCGGGTTGGACTTTTGAACTTAT AGACTGATATCACTGACTACAAAGTTGAGGGTATTGGTTATGATTTTGTTCCTCAGGTTT 1021 ---------+---------+---------+------g--+---------+---------+ TCTGACTATAGTGACTGATGTTTCAACTCCCATAACCAATACTAAAACAAGGAGTCCAAA TGGACAGAAAATTAATTGATGTTTGGTATAAGACAGACGACAAGCCTTCTTTCAAATACG 1081 ---------+---------+---------+---------+---------+---------+ ACCTGTCTTTTAATTAACTACAAACCATATTCTGTCTGCTGTTCGGAAGAAAGTTTATGC CCAGACAATTGATTTCTAACGAAGGTGTCTTGGTGGGTGGTTCTTCCGGTTCTACCTTCA 1141 ---------+---------+---------+---------+---------+---------+ GGTCTGTTAACTAAAGATTGCTTCCACAGAACCACCCACCAAGAAGGCCAAGATGGAAGT CTGCGGTTGTGAAATACTGTGAAGACCACCCTGAACTGACTGAAGATGATGTCATTGTTG 1201 ---------+---------+---------+---------+---------+---------+ GACGCCAACACTTTATGACACTTCTGGTGGGACTTGACTGACTTCTACTACAGTAACAAC CCATATTCCCAGATTCCATCAGGTCGTACCTAACCAAATTCGTCGATGACGAATGGTTGA 1261 ---------+---------+---------+---------+---------+---------+ GGTATAAGGGTCTAAGGTAGTCCAGCATGGATTGGTTTAAGCAGCTACTGCTTACCAACT AAAAGAACAATTTGTGGGATGATGACGTGTTGGCCCGTTTTGACTCTTCAAAGCTGGAGG 1321 ---------+---------+---------+---------+---------+---------+ TTTTCTTGTTAAACACCCTACTACTGCACAACCGGGCAAAACTGAGAAGTTTCGACCTCC CTTCGACGACAAAATACGCTGATGTGTTTGGTAACGCTACTGTAAAGGATCTTCACTTGA 1381 ---------+---------+---------+---------+---------+---------+ GAAGCTGCTGTTTTATGCGACTACACAAACCATTGCGATGACATTTCCTAGAAGTGAACT AACCGGTTGTTTCCGTTAAGGAAACCGCTAAGGTCACTGATGTTATCAAGATATTAAAAG 1441 ---------+---------+---------+---------+---------+---------+ TTGGCCAAGAAAGGCAATTCCTTTGGCGATTCCAGTGACAACAATAGTTCTATAATTTTC ACAATGGCTTTGACCAATTGCCTGTGTTGACTGAAGACGGCAAGTTGTCTGGTTTAGTTA 1501 ---------+---------+---------+---------+---------+---------+ TGTTACCGAAACTGGTTAACGGACACAACTGACTTCTGCCGTTCAACAGACCAAATCAAT CTCTCTCTGAGCTTCTAAGAAAACTATCAATCAATAATTCAAACAACGACAACACTATAA 1561 ---------+---------+---------+---------+---------+---------+ GAGAGAGACTCGAAGATTCTTTTGATAGTTAGTTATTAAGTTTGTTGCTGTTGTGATATT AGGGTAAATACTTGGACTTCAAGAAATTAAACAATTTCAATGATGTTTCCTCTTACAACG 1621 ---------+---------+---------+---------+---------+---------+ TCCCATTTATGAACCTGAAGTTCTTTAATTTGTTAAAGTTACTACAAAGGAGAATGTTGC AAAATAAATCCGGTAAGAAGAAGTTTATTAAATTCGATGAAAACTCAAAGCTATCTGACT 1681 ---------+---------+---------+---------+---------+---------+ TTTTATTTAGGCCATTCTTCTTCAAATAATTTAAGCTACTTTTGAGTTTCGATAGACTGA TGAATCGTTTCTTTGAAAAAAACTCATCTGCCGTTATCACTGATGGCTTGAAACCAATCC 1741 ---------+---------+---------+---------+---------+---------+ ACTTAGCAAAGAAACTTTTTTTGAGTAGACGGCAATAGTGACTACCGAACTTTGGTTAGG ATATCGTTACTAAGATGGATTTACTGAGCTACTTAGCATAAATAAGAACCCACGCTTCAA 1801 ---------+---------+---------+---------+---------+---------+ TATAGCAATGATTCTACCTAAATGACTCGATGAATCGTATTTATTCTTGGGTGCGAAGTT ATAAAAGCAAACATAGAAGCAAAATCCGTCATTCCTTTCCTATTCAATTGCACCGTTCTC 1861 ---------+---------+---------+---------+---------+---------+ TATTTTCGTTTGTATCTTCGTTTTAGGCAGTAAGGAAAGGATAAGTTAACGTGGCAAGAG TTTATATAACTACTTAATTAAATAGCGCCTATACGAAGCAGCATTGTTCTATTATTTTTA 1921 ---------+---------+---------+---------+---------+---------+ AAATATATTGATGAATTAATTTATCGCGGATATGCTTCGTCGTAACAAGATAATAAAAAT CAAATTCCTTATCATGCATGCATCACATCAGTGTTTGAATCTGTTAACTTTTCACTTTAT 1981 ---------+---------+---------+---------+---------+---------+ GTTTAAGGAATAGTACGTACGTAGTGTAGTCACAAACTTAGACAATTGAAAAGTGAAATA A. Transcription and Translation—Practice RNA Polymerase complex binds to the two TATA-type elements underlined and bolded above. Once bound, RNA polymerase starts making mRNA somewhere between 40 and 120 base pairs downstream of the last TATA element. 1. If transcription starts 40 base pairs downstream of the last TATA element, at base pair #253, write the sequence of the first 10 nucleotides of the resulting mRNA. Label 5’ and 3’ ends. 5’-UUGAAGAUUU…-3’ 2. If transcription starts 90 base pairs downstream of the last TATA element, at base pair #303, write the sequence of the first 10 nucleotides of the resulting mRNA. Label 5’ and 3’ ends. 5’-GACGUAAGAA…-3’ 3. In each case, what are the first eight amino acids of the resulting protein? In this case, does the transcription start site influence the sequence of the resulting protein? N-Met-Thr-Lys-Ser-Glu-Gln-Gln-Ala-…C Transcription start site does not influence the sequence of protein, because the first ATG occurs after either of the start sites. 4. Does translation terminate at the TAA at the underlined position 353 (a)? Why or why not? No, this TAA is not in frame of translation. 5. How would your answer to 3 change if the C/G base pair at position 339 (b, bold) was deleted? What effect, if any, do you expect this mutation to have on the resulting CBS protein? Amino acid 8, Ala would be changed to Pro. 6. How would your answer to 3 change if an A/T base pair was added between 328 & 329 (c, bold)? What effect, if any, do you expect this mutation to have on the resulting CBS protein? Early stop would be created, and the sequence would read N-Met-Thr-Lys-Ser-C 7. How would your answer to 3 change if the A/T base pair at position 383 (d, bold) were changed to a G/C? What effect, if any, do you expect this mutation to have on the resulting CBS protein? No change for answer in 3. And no change for the protein—silent mutation. 8. Give a single base change (substitution, deletion, or addition of a single base and it's partner on the other strand) that would cause termination of the polypeptide chain at TAA codon 374 (e, underlined). Insert a base pair anywhere between the ATG and the TAA in question. 9. Give an example of a nonsense mutation (codon --> stop codon). TGTÆTGA (cysÆstop) 10. Give an example of missense mutation (codon --> codon for another amino acid). AATÆAAA (ansÆlys) 11. Give an example of silent mutation (codon ---> codon for the same amino acid). AGAÆCGA (argÆarg) 12. A mutation in what codon(s) always results in a change in the primary sequence of the resulting protein? Trp, Met—only one codon per each of these amino acids. 13. The actual stop codon for CBS is at bases 1839-1841 (underlined). What would the effect of the A1841C mutation be on the CBS protein? The protein would acquire a “tail”—there is another TAA stop codon 1935-1937. B. Transcription and Translation—Functional effects Recall that yeast that lack CBS protein can not synthesize the amino acid cysteine. Mutant versions of the human CBS protein can lead to a very serious disease called homocystinuria. Some symptoms include mental retardation, early strokes and heart disease. Recall also that in Section 3 we encountered a crystallographic model of a form of CBS protein. Consider the model again. This model is of a truncated form of the human CBS protein. Yeast and human proteins are very similar (72%), and some sections are identical (38%). I. Mutation 1-- Treatable 1. Take a look at bases 969-971 (f, bold). a. What amino acid is encoded? Val b. What kind of amino acid is it? hydrophobic c. Where in a protein might you expect to find it? Inside the protein, with other hydrophobics In the human CBS protein, this amino acid corresponds to Ile278. 2. What type of amino acid is Ile? Would you expect to find it in the same environment as the amino acid in 1 or not? Explain. Also hydrophobic—same environment. Choose “Isoleucine 278” on the crystallographic model exercise. 3. What type of secondary structure element is it located in? β-sheet 4. What type of amino acids would you expect to surround it? Other hydrophobic residues Choose “Isoleucine 278 and Neighbors” on the crystallographic model exercise. 5. What amino acids is Ile278 in contact with? Ala, Ile, Leu 6. What type of amino acids are those? All hydrophobic A human mutation leading to a serious but somewhat treatable case of homocystinurea is caused by the equivalent of G969A and T970C mutations in yeast. 7. What amino acid would be created in yeast with those substitutions? Thr 8. Is a mutation causing this amino acid substitution more likely in humans or in yeast? Why? More likely in humans—only one change required. 9. What would be the effect of this mutation be on the tertiary structure of CBS? Why? Structure less strongly held together—hydrophilic amino acid inserted into a hydrophobic cluster would cause the cluster to not associate as strongly as before.. The only known treatment for homocystinurea is to supplement patient’s diet with large quantities of vitamin B6. B6 is the co-factor for human CBS. 10. In general, why would adding more co-factor to a deficient enzyme help restore some of the function? The co-factor can saturate the enzyme, such that the bottle neck step is the catalysis, and not complex formation. 11. How do you suppose does the treatment overcome the deficiency in the mutant CBS? It is possible that the bound co-factor holds this complex tighter together, overcoming some of the problem introduced by the mutation. II. Mutation 2-- Untreatable 12. Take a look at bases 1056-1058 (g, bold). a. What amino acid is encoded? Gly b. What kind of amino acid is it? Does it have any special properties? This is a smallest amino acid. c. Where in a protein might you expect to find it? We would expect to see it in tight spaces in the protein. In the human CBS protein, this amino acid corresponds to Gly307. Choose “Glycine 307” on the crystallographic model exercise. 13. Does it belong to any secondary structure element? No secondary structure 14. What type of amino acids would you expect to surround it? Hydrophobics—inside the protein. Choose “Glycine 307 and Neighbors” on the crystallographic model exercise. 15. What amino acids is Gly307 in contact with? Tyr, Ile 16. What type of amino acids are those? Hydrophobic and large A human mutation leading to a severe and untreatable case of homocystinurea is caused by the equivalent of G1056A mutation in yeast. 17. What amino acid would be created in yeast with that substitution? Ser 18. Is a mutation causing this amino acid substitution more likely in humans or in yeast? Why? Same likelihood—one mutation required in each case. 19. What would be the effect of this mutation be on the tertiary structure of CBS? Why? It would be less tightly held together because Ser might disrupt the tight packing and also disrupt the hydrophobic pocket. This mutation in humans does not respond to the vitamin B6 treatment. 20. What are the possible reasons that one mutation would respond to treatment and another would not? Responsiveness to treatment is likely influenced by the location of the affected amino acid in the protein. Location in the 3D structure of the protein influences the role of a particular amino acid in the function of the protein. C. Transcription and Translation—Conclusions 1. Where is all the information needed to properly execute transcription and translation recorded? DNA 2. Is all this information accessible to the same machinery? No—different machinery reads each. 3. Is the stop codon in position 1839 where transcription of the CBS gene stops? Why or why not? No—stop codon is read by the ribosome, and transcription termination is enacted by the RNA Pol complex. The Genetic Code U C A G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG U phe phe leu leu leu leu leu leu ile ile ile met val val val val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG C ser ser ser ser pro pro pro pro thr thr thr thr ala ala ala ala UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A tyr tyr STOP STOP his his gln gln asn asn lys lys asp asp glu glu UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG G cys cys STOP trp arg arg arg arg ser ser arg arg gly gly gly gly U C A G U C A G U C A G U C A G STRUCTURES OF AMINO ACIDS at pH 7.0 O O C H C CH3 H CH2 SH H NH3 + O H N O + C H H CH2 NH3 + N C O C H C CH2CH2 S CH3 H NH3 + METHIONINE (met) C O C CH2 H CH3 NH OH + 3 THREONINE (thr) C CH2 LYSINE (lys) O O H NH3 + H H H O O H H H C C H O O C CH2 OH NH3 + H TYROSINE (tyr) H OH SERINE (ser) C H CH2 NH3 + PROLINE (pro) H C C H C CH2 CH2 H N CH2 H + H O O C H CH2CH2CH2CH2 C NH3 + CH3 H N TRYPTOPHAN (trp) H CH3 LEUCINE (leu) H O C C NH3 + H C GLYCINE (gly) H PHENYLALANINE (phe) O O O C H C H CH2 C NH3 + O C NH3 + H CH2CH3 O O C H NH2 C ISOLEUCINE (ile) HISTIDINE (his) H C O O NH3 CH3 + H H O C C CH2CH2 GLUTAMINE (glN) O C H O C O C O ASPARTIC ACID (asp) O NH3 + GLUTAMIC ACID (glu) C C H CH2 C NH3 + O C O NH3 + CYSTEINE (cys) H C O C NH2 ASPARAGINE (asN) O CH2CH2 H CH2 C NH3 + O C C O C NH2 + C C NH2 O O C O C ARGININE (arg) O H CH2CH2CH2 N C H O O C H NH3 + ALANINE (ala) O O C NH3 + O O O H C CH3 C NH3 H + CH3 VALINE (val) NH3+