University:
ECPI University
Course:
MED152 | Human Anatomy & Physiology I
Academic year:

2024
Views:

149

Pages:

2
Author:

R. Deaton

Questions: 1. Using your own words, draw the processes of replication, transcription and translation. Take a photo or scan a copy of your drawing and upload it as a file. Attached. 2. Using ATGCTTTACTGAGGACTAGCT as the template strand, find its complement and transcribe and translate the DNA. Take a photo or scan a copy of your drawing and upload it as a file. Complement: TACGAAATGACTCCTCGA RNA: UACGAAAUGACUCCUCGA Methionine threonine proline arginine 3. Which molecules are involved in translation? In at least 5-6 sentences, discuss the roles of each molecule. Translation is the process of converting the genetic code, carried by mRNA, into a sequence of amino acids that becomes a protein. The molecules involved in translation are tRNAs (transfer RNAs) and ribosomes. tRNAs are like bridges and they connect the mRNA codons to the amino acids they encode. The other end of the tRNA carries the amino acid specified by the codons. The ribosomes are where the proteins are built. They are made of protein and RNA. The ribosomes provide a slot where tRNAs can find their matching codons on the mRNA template and deliver their amino acids. Questions: (All answers should include at least 4-6 sentences)- Mitosis 1. In your own words, describe the process of mitosis. Mitosis is where the division of the nucleus takes place. Mitosis is then broken down into 4 phases. 2. Discuss the steps of mitosis. Include the processes that take place at each step. The first phase of mitosis is prophase. Where chromatin condenses into chromosomes. Centrioles then move to opposite sides of the cytoplasm, and the nuclear envelope and nucleolus disperse. The second phase of mitosis is metaphase where the complete alignment of chromosomes on the center lining of the cells occurs. The third phase is anaphase where the sister chromatids are split and the spindle fibers pull apart. The fourth phase is telophase where the chromosomes return to their normal structure wound around proteins and the cells start to pull away for cytokinesis or division of the cytoplasm. 3. Discuss the importance of the spindle fibers. Spindle fibers form a protein structure that divides the genetic material in a cell. They're necessary because they equally divide the chromosomes. 4. Discuss the processes that are taking place during interphase. There are two phases of interphase. The first one is the S (synthesis) phase and this is where DNA replication takes place. The second phase of interphase is G1 and G2 (growth or gap) phases and this is where structures other than DNA are replicated and the cell grows during them.