Solutions to Practice Problems for Recombinant DNA, Session 5: Agarose Gel Electrophoresis, DNA Sequencing, and PCR

Solutions to Practice Problems for Recombinant DNA, Session 5: Agarose Gel Electrophoresis, DNA Sequencing, and PCR Question 1 You make a cDNA library by cloning the cDNA fragments into a unique EcoRI restriction site in the vector. You identify a recombinant vector that you believe has the gene of interest. a) How can you use the EcoRI restriction enzyme to tell you if the gene has been inserted? You would inoculate media with some cells from the colony that you have identified. You would allow many cells to grow, and then isolate the vector from these cells. Once you have the vector DNA, you would digest it with EcoRI, and separate the resulting DNA fragments on an agarose gel. If your vector had a cDNA inserted into the EcoRI site, you will see at least two bands on your gel. Suppose you find that the gene of interest is in the vector, but now you want a restriction map of the recombinant plasmid. You take three individual samples of the plasmid and digest one sample with EcoRI, the second sample with HindIII, and the third sample with both EcoRI and HindIII. Then you run the digested DNA on an agarose gel to see the fragments. 5.3 4.1 3.0 2.7 2.3 1.5 1.1 0.4 b) Considering that the cDNA fragment is smaller than the vector… • Circle the fragments on the gel that contain all or part of the cDNA. • Draw the restriction map of this recombinant plasmid. Eco RI 1.1 kb Hind III 0.4 kb 3.0 kb 2.3 kb Hind III Eco RI Question 2 a) Given the sequence below, design primers, each 16 nucleotides long, which would allow you to generate many copies of a PCR product that was 400 base pairs long GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTTGTCAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG 1 +---------+---------+---------+---------+---------+---------+---------+--------CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC GGGTGGCCAACTTGGGCGAGAAAAGGTATATAAAGGTCTCTTGCTCCCATCAACTGCCTCAAAAGTAGGTATTCCAGCAG 81 +---------+---------+---------+---------+---------+---------+---------+--------CCCACCGGTTGAACCCGCTCTTTTCCATATATTTCCAGAGAACGAGGGTAGTTGACGGAGTTTTCATCCATAAGGTCGTC ATCAGACAACGTCAGGTGGGAGGACTTGGACGGAAAAGTAGAAGGTCAAGACCAACCTCTTCCAATCCAACCACAAACAA 161 +---------+---------+---------+---------+---------+---------+---------+--------TAGTCTGTTGCAGTCCACCCTCCTGAACCTGCCTTTTCATCTTCCAGTTCTGGTTGGAGAAGGTTAGGTTGGTGTTTGTT AAAATCAGCCAATATGTCCGACTTCGAGAACAAGAACCCCAACAACGTCCTTGGCGGACACAAGGCCACCCTTCACAACC 241 +---------+---------+---------+---------+---------+---------+---------+--------TTTTAGTCGGTTATACAGGCTGAAGCTCTTGTTCTTGGGGTTGTTGCAGGAACCGCCTGTGTTCCGGTGGGAAGTGTTGG CTAGTATGTATCCTCCTCAGAGCCTCCAGCTTCCGTCCCTCGTCGACATTTCCTTTTTTTTCATATTACATCCATCCAAG 321 +---------+---------+---------+---------+---------+---------+---------+--------GATCATACATAGGAGGAGTCTCGGAGGTCGAAGGCAGGGAGCAGCTGTAAAGGAAAAAAAAGTATAATGTAGGTAGGTTC Primer 1: 5’ G G A C C G C G G G G C A G G A 3’ Primer 2: 5’ C T T G G A T G G A T G T A A T 3’ b) When using the Dideoxy Chain Termination method for sequencing DNA you include only a small amount of ddATP, ddCTP, ddGTP, and ddTTP. • Give two differences between the ddATP used in the sequencing reaction and the regular dATP. The ddATP would be missing the 3’ OH that is found on dATP and it would have some marker that will allow visualization. • Explain why your the Dideoxy Chain Termination method for sequencing DNA would not work if you included too much ddATP, ddCTP, ddGTP, or ddTTP. If you included too much ddATP, ddCTP, ddGTP, or ddTTP, then each elongation reaction would incorporate a ddNTP very early in the reaction. This would cause all of the products to terminate near their 5’ end and you would never generate products that would allow you to determine the sequence of the end of the template.